Съедобные птицы: Разные виды мяса. Все ли вы попробовали? Кулинарные статьи

Содержание

Разные виды мяса. Все ли вы попробовали? Кулинарные статьи

Мясо является частью человеческого рациона с незапамятных времен. Археологические свидетельства показывают, что люди употребляли его с тех пор, как научились охотиться. С началом потребления мяса крупных животных охотникам приходилось объединяться в большие группы, и охота принимала все более организованный характер. Постепенно животных и птиц стали приручать, чтобы всегда иметь под рукой мясо, молоко и яйца. Первыми были одомашнены овцы, за ними последовали разные виды рогатого скота и свиньи, а уж только затем – птицы.

В разных странах и культурах употребляются в пищу разные виды мяса. Это зависит от традиций, религиозных убеждений и других причин. Наличие тех или иных животных и доходы населения тоже играют не последнюю роль.

Мясо – это плоть животных, обычно млекопитающих, которую человек употребляет в пищу. Мясом называют, в основном, скелетные мышцы животного и жир, прилегающий к ним, хотя им же являются и внутренние органы, такие как легкие, печень, почки, головной мозг, кожа и костный мозг. Рыба и птица к мясу не относятся. Правда, в последнее время и их плоть тоже часто называют мясом.

Пищевые привычки и рацион людей в разных странах разный. Одни употребляют в пищу мясо оленей, а другие – пауков, крыс, зебр или змей.

В нашей стране мясом насыщены те регионы, где распространено сельское хозяйство, и помимо пастбищ имеются зернохранилища.

Производство мяса по регионам

Виды мяса животных

К мясным домашним животным относятся коровы, лошади, козы, овцы, свиньи и другие. Верблюдов и кенгуру тоже употребляют в пищу там, где они водятся.

Человек питается и дикими животными, такими как кабаны, лоси и олени. Мясо диких животных называется «дичь».

Мясо коровы называется говядиной, теленка – телятиной, овцы – бараниной, оленя – олениной. Говядина, баранина, свинина и мясо других млекопитающих называется красным. Оно считается нездоровым, если потреблять его в больших количествах.

Людям больше всего нравятся следующие виды мяса

– свинина;
– говядина;
– баранина;
– крольчатина;
– оленина;
– конина;
– мясо дикого кабана;
– мясо бизона.

Виды мяса птицы домашней и дикой

Плоть и домашних, и диких птиц определенных видов тоже употребляется человеком в пищу. Люди едят и птичьи яйца. К съедобным птицам относятся курица, утка, гусь, голубь, индейка, цесарки, эму, страусы и другие. По сравнению с красным мясом млекопитающих, птица считается более полезной. У птиц можно есть разные части тела: грудку, голени, бедрышки, шеи и прочее. Наиболее полезной считается грудка.

Самой популярной съедобной птицей считаются

– курица;
– индейка;
– утка;
– страус;
– перепелки;
– куропатки;
– голуби;
– цесарки.

Виды мяса рыбы

Как и домашняя птица, рыба не считается мясом, хотя ее плоть иногда именно так и называют. Рыба является основным продуктом питания во многих частях мира. Люди потребляют как морскую, так и пресноводную рыбу. В некоторые странах едят и таких огромных рыб, как киты и дельфины.
Хорошая рыбалка начинается с мая, когда рыба продолжительно нерестится, у хищных рыб начинается жор. Это щука, окунь, судак, сом. Также клюет карп, карась, язь и лещ.

Плоть рыбы считается полезнее красного мяса и даже птицы потому, что содержит мало жира и много омега-3 жирных кислот. Диетологи рекомендуют употреблять в пищу мелкую рыбу, такую, как сардина. Большая рыба вроде тунца содержит ртуть, что при большом ее употреблении может быть вредным для здоровья, поэтому ею злоупотреблять не следует.

Самая распространенная для питания рыба

– лосось;
– палтус;
– филе акулы;
– сом;
– тунец;
– кит;
– рыба-меч.

Выше были перечислены разные виды мяса, которые используются практически повсеместно. Мясо зебр, опоссума, буйволов, верблюдов едят только в тех регионах, где эти животные водятся.

Какое мясо полезнее


В настоящее время производство мяса является одной из самых процветающих отраслей пищевой промышленности. Мясо бывает обычное, органическое и мясо животных, которые питаются только подножным кормом. «Обычное» мясо – это мясо животных, выращенных на фермах. Органическое – это мясо животных, в питании которых не использовалось никаких химических веществ, антибиотиков или гормонов, которые обычно вводят сельскохозяйственным животным. Что касается животных, питающихся подножным кормом, тут и так все понятно.

Если вы любите мясо, старайтесь есть меньше красного и ешьте больше белого, чтобы оставаться здоровым.

Автор статьи: Семенова Наталья «Гранд Кулинар»

От курицы до страуса: выбираем самое полезное мясо птицы | Продукты и напитки | Кухня

Мясо птицы – не менее питательно и полезно, чем красное мясо млекопитающих, в нем много полезных веществ, витаминов и минералов. Белки, содержащиеся в птичьем мясе, усваиваются даже лучше, кроме того, мясо птицы богато полезными жирами, что позволяет лучше усваиваться и витаминам.

Приверженцы здорового питания часто отдают предпочтение птичьему мясу из-за его низкой калорийности, а белка в птице содержится даже чуть больше, чем в той же говядине.

Так какое же птичье мясо самое полезное, и каковы особенности каждого вида:

Фото:mmenu.
com

Индейка

Мясо этой птицы считается самым полезным и самым диетическим из всего спектра птичьего мяса. Оно содержит небольшое количество жиров, да и те полезные, полиненасыщенные, что изгоняют вредный холестерин из организма. Также в индюшачьем мясе содержится очень много витаминов А и Е, витаминов-антиоксидантов, которые защищают организм от старения, поддерживают его жизненные силы, дарят бодрость и энергию. Также в индюшачьем мясе высокое содержание натрия, в два раза выше, чем в говядине, поэтому, готовя индейку, можно не использовать соль. По содержанию железа мясо индейки — рекордсмен и намного опережает говядину, свинину и курятину вместе взятые. В этом мясе много кальция, что позволяет употреблять его в целях профилактики остеопороза, оно предотвращает болезни суставов.

Фото:mmenu.com

Курица

Самое распространенное, легкодоступное и одно из самых полезных. Курятина ценится в первую очередь тем, что белок, содержащийся в этом мясе, самый легко усваиваемый. К тому же его довольно много. А содержит белок куриного мяса – 92 % необходимых нам аминокислот. Также в курятине содержатся витамины B2, В6, В9, В12 и железо, фосфор, селен, кальций, магний, медь.

Куриное мясо рекомендуют при заболеваниях сердечно-сосудистой системы, отлично подходит курица для разгрузочного питания при ожирении, так как калорий она приносит мало, а пользы – очень много. Только нужно снимать кожу – в ней много жира.

Фото:mmenu.com

Утка

 

Основное достояние утки – высокое содержание в ее мясе жирных кислот Омега-3, которые необходимы для успешной работы мозга, поддерживают в порядке сердце, делают кожу сияющей. Еще одна особенность мяса – высокое содержание витамина D, он помогает усваиваться кальцию, повышает иммунитет, укрепляет мышцы и кости, так что жизненно необходим нашему организму. Также в утином мясе очень много витамина Е. Есть еще витамины группы B и полезные минералы: селен, фосфор, цинк, калий, кальций…

При употреблении утиного мяса нужно учитывать его высокую жирность и калорийность.

Фото:mmenu.com

Гусь

Несмотря на то, что гусиное мясо ругают за высокую жирность – оно очень ценное. Отдают должное гусю не только за сладковатый оригинальный привкус мяса, но и за высокое содержание витаминов и минералов: кальция, цинка, железа, витаминов группы B (В6, В1, В2), витаминов А и С. Кроме того, жирное мясо гуся ценится из-за высокого содержания полезных полиненасыщенных жирных кислот. Регулярное употребление гусятины успокоит желудок, очистит организм от токсинов, избавит от диареи, вылечит нарушения селезенки.

Как приготовить гуся, фаршированного кашей и яблоками>>>

Фото:shutterstock.com

Перепел

Перепелиные яйца мы используем достаточно часто, ценим их за вкус, милый вид и питательность. А вот мясо перепела встречается на наших столах редко. Между тем это мясо не уступит в пользе остальным видам птичьего мяса, а в чем-то даже и превзойдет. Вот только по цене и экономичности здорово проиграет той же индюшатине, не говоря уже о курице.

Зато пользы в перепелином мясе – очень много. Витамины: С, А, РР, почти вся группа B. Минералы: кальций, железо, фосфор, калий, селен… Легкоусваиваемый белок, рекордное количество аминокислот, полезные жиры… В общем все преимущества птичьего мяса и даже больше. Не даром перепел так любим диетологами.

Фото:shutterstock.com

Страус

Очень экзотическое для нашей страны мясо, тем не менее, оно входит в оборот и у российских поваров и продавцов, становятся все популярнее страусиные фермы. Мясо страуса отличается очень низкой калорийностью (114 Ккал на 100 г) и низкой жирностью, при этом содержание белка довольно высоко – 22 %. Еще в страусином мясе содержатся марганец, фосфор и калий.

Мясо страуса имеет красный цвет и по вкусу схоже с телятиной, но отличается особенной нежностью. Повара всего мира ценят страусятину за чуткость: мясо легко пропитывается ароматами овощей и пряностей при готовке.

Возможно вам будет интересно: Почему страус прячет голову в песок →

Нежные съедобные птицы — Delicate Edible Birds

Delicate Edible Birds — сборник рассказов, написанный Лорен Грофф . Грофф родился и вырос в Куперстауне , штат Нью-Йорк, в доме американских писателей Джеймса Фенимора Купера и лорда WW. Действие нескольких историй происходит в северной части штата Нью-Йорк . Грофф также является автором бестселлера «Монстры Темплтона» .

Резюме

Антология состоит из девяти драматических рассказов, взятых вместе, охватывающих столетие. В каждой истории раскрывается кусочек жизни разных американок.

  • «Lucky Chow Fun» разворачивается в мифическом Темплтоне ( Куперстаун, Нью-Йорк ), в месте действия ее первого романа. В этой сказке семнадцатилетняя Лолли надеется уехать в колледж, не оглядываясь назад, но зловещие события в конечном итоге заставляют ее опасаться за безопасность своей младшей сестры и будущее ее некогда безопасного городка.
  • «Л. Дебар и Алиетта» — это хитрый пересказ истории Абеляра и Элоизы в Нью-Йорке во время пандемии гриппа 1918 года .
  • «Мажоретта» — это история личностного роста молодой женщины из Херши, штат Пенсильвания, и событий, которые сделали ее более мирской, а также об отце и дедушке, которые всегда глубоко привязаны к своей маленькой девочке.
  • «Блайт» — это история скучающего, интровертированного адвоката из Филадельфии, который превратился в домоседку, чья жизнь меняется, когда она идет на вечерний урок и встречает экстравертную и эксцентричную женщину, которая ее привлекает.
  • «Жена диктатора» — это этюд простой американской девушки, которая выходит замуж за латиноамериканского диктатора. Ее судьба неумолимо связана с его.
  • «Сэр Флитинг» — это история, в которой фермерская девушка со Среднего Запада во время медового месяца в Аргентине впадает в пожизненную похоть французского плейбоя.
  • «Водораздел» — это трагедия между мужем и женой, которая доказывает принцип «не говори того, о чем потом пожалеешь».
  • Действие «Нежных съедобных птиц» происходит во время падения Франции. Разрозненная, но тесная группа военных корреспондентов против их воли удерживается злым французским фермером, который требует высокую цену в обмен на то, что не передаст их нацистам.

Символы

  • Лолли из «Lucky Chow Fun» — семнадцатилетняя старшеклассница , надеющаяся уехать в колледж без страха и сожаления, но внезапно обнаруживает, что ее причудливый городок стал зловещим местом.
  • Алиетт в «Л. Дебар и Алиет» — молодая женщина, временно заболевшая полиомиелитом, которая влюбляется в старшую Л. Дебарда.
  • Берн в «Нежных съедобных птицах» — смелая, привлекательная женщина-военный корреспондент, чья потеря личной чести во имя выживания других является аллегорией для самой Франции.

Отзывы

  • Нежные съедобные птицы Лорен Грофф Рецензия на книгу Клэр Хоупли, The Washington Times , 22 февраля 2009 г.
  • Обзор книги «Нежные съедобные птицы: и другие истории», Publishers Weekly , 12 декабря 2008 г.

Похвалы

  • Заглавный рассказ «Нежные съедобные птицы» был выбран в антологии «Лучшие американские рассказы 2010 года».
  • «Л. Дебард и Алиетт» был выбран в антологии «Лучшие американские рассказы 2007 года» и был рекомендован О’Генри.
  • «Lucky Chow Fun» выиграл приз Pushcart в 2008 году.

Рекомендации

<img src=»//en. wikipedia.org/wiki/Special:CentralAutoLogin/start?type=1×1″ alt=»» title=»»>

Съедобные экокормушки для птиц на меду изобрели в детском саду в ЕАО

26 декабря, РИА Биробиджан.

Маленькие открытия случаются в ходе стартовавшей в Еврейской автономной области экологической акции «Покормите птиц зимой». Так, в детском саду №37 Биробиджана помимо традиционных кормушек развешали на деревьях шишки, вывалянные в крупах, сообщила РИА Биробиджан старший воспитатель МБДОУ Екатерина Редько.

В принципе, такие оригинальные экокормушки известны давно. Но обычно в качестве связующего материала используют желатин и различные жировые субстанции. В детском саду №37 использовали другой «закрепитель» — поистине дальневосточный.

Экологические кормушки сконструировали в МБДОУ №37 Биробиджана

«В подготовительной группе воспитатель Татьяна Федоровна Желторылова  открыла экологическую творческую мастерскую «Необыкновенные приключения еловой шишки». Сначала дети совместно с педагогом сделали массаж с еловыми шишками, потом окунули их в мёд и в крупу разных видов. В итоге получили замечательные съедобные кормушки. На прогулке каждый ребёнок разместил шишку для птиц на ветках деревьях», — рассказала Екатерина Редько.

По ее словам, в этом году многие дошкольные и школьные учреждения города проводят экологические акции с целью оказания помощи зимующим птицам.

Экологические кормушки сконструировали в МБДОУ №37 Биробиджана

«Педагоги и родители нашего детского сада  активно присоединились к проведению акции «Покормите птиц зимой». В течении месяца родители совместно с детьми изготавливали кормушки для птиц, вместе они смело взялись за дело, подключили фантазию и смекалку, в результате получились оригинальные и вместительные конструкции: из дерева, пластмассовых банок и картонных коробок. У каждого на свой вкус! После того, как кормушки были изготовлены, дети презентовали их, рассказывая, из какого материала кормушка изготовлена и для каких птиц предназначена. Перед тем, как вывешивать кормушки, педагоги познакомили детей с правилами подкормки птиц, для того, чтобы они знали, как называется тот или иной посетитель «столовой», чем он любит лакомиться, рассматривали картинки, читали книги, смотрели презентации, проводили познавательные занятия, беседы, игры», — отметила педагог.

Экологические кормушки сконструировали в МБДОУ №37 Биробиджана

В детском саду не нарадуются теперь, как дети заботливо относятся к птицам и ежедневно дежурят: чистят кормушки, пополняют их собранным кормом. И внимательно наблюдают за весёлыми стайками пернатых.

«Благодаря ежегодной акции «Покормите птиц зимой», мы сохраняем численность птиц родного края, облегчаем жизнь пернатых друзей в суровую зимнюю пору. Немаловажным является и то, что благодаря педагогам и родителям, дети учатся быть добрыми и милосердными, помнить о тех, кто нуждается в их заботе», — считает Екатерина Редько.

#riabir #риабир #новости #ЕАО #Биробиджан #дети #птицы #кормушки

Фото предоставлено МБДОУ «Детский сад №37» г. Биробиджана

1563 просмотров

Почему не едят чайку. Яйца диких птиц

На вопрос Почему ЧАЕК нельзя употреблять в пищу? Какое то поверье? Или они не вкусные? заданный автором Прослезиться лучший ответ это

Источник:

Ответ от Европейский [активный]
Для многих людей поэтический образ чайки – символ свободы, простора и мечты.
Среди моряков существует поверье, что чайки – это души погибших в морской пучине…
Какие же еще поверья связаны с этой птицей?
Убийство чайки приносит несчастье. (Распространенное морское поверье) .
Чибиса и чайку у славянских народов запрещалось убивать.
В Карелии чайку убить — грех большой.
У англичан поймать чайку — накликать беду, поскольку чайки — это души усопших.
Английские моряки твердо верят, что убийство чайки приносит несчастье в плавании.
Если в наше время застрелить чайку, то это действительно чревато неприятностями,
потому что в некоторых районах эти птицы охраняются законом.
В старые времена, однако, жизнь им сохранял только предрассудок.
Это суеверие проистекает из факта, что чайка — полезный санитар береговой линии,
поедающий дохлую рыбу и падаль. Если бы они оставались гнить на берегу,
это вполне могло бы стать причиной эпидемии.
Почему же нельзя употреблять в пищу мясо чаек? Ответ можно найти в Библии!
В Библии содержатся законы и правила, которые учат нас, что можно принимать в пищу.
Также мы находим указания относительно того, каким образом нужно забивать животное,
а также, какие его части непригодны в пищу. Соответственно, это получило название чистого и нечистого мяса.
Птиц можно есть, но не всех. В весьма длинный список запрещенных птиц вошли хищные и рыбоядные птицы, а также птицы, питающиеся падалью и птицы-мусорщики. К ним как раз и относятся чайки.
Большая морская чайка — всеядная птица с большой склонностью к хищничеству. Питается рыбой, в том числе довольно крупной, яйцами, птенцами и взрослыми птицами, особенно обитающими на птичьих базарах (кайры, моевки и др.) . Поедает также леммингов, падаль и всякого рода отбросы, водных ракообразных, морских ежей.
Рыбу сама чайка ловит неохотно, а обычно собирает на месте рыбных промыслов. Рыба, птенцы и яйца морских птиц служат главным кормом и для птенцов.
«Из птиц же гнушайтесь сих [не должно их есть, скверны они] : орла, грифа и морского орла, коршуна и сокола с породою его, всякого ворона с породою его, страуса, совы, чайки и ястреба с породою его, филина, рыболова и ибиса, лебедя, пеликана и сипа, цапли, зуя с породою его, удода и нетопыря. «
У Бога были серьезные причины запрещать нам употреблять в пищу мясо этих птиц. Одной из наиболее очевидных является то, что большинство, если не все из этих птиц питаются падалью. Это означает, что они едят, в том числе, и мясо мертвых животных. Это не сулит человеку, который ест это мясо, ничего хорошего, поскольку их мясо может оказаться источником какого-нибудь заболевания. В их организме также содержаться ферменты, помогающие им переваривать эту падаль и мясо других нечистых животных, которые могут оказаться губительными для человека.
Относятся ли уставы о чистой и нечистой пище к новозаветным временам? Принципы здоровой жизни никак не меняются со временем. Больше того, с ростом болезней, поражающих животный мир, человеку необходимо быть более разборчивым и требовательным к собственному питанию, а также к своему образу жизни в целом.

Читая книгу Джерри Хопкинса «Экстремальная кулинария», задумался о некоторых видах животных в смысле их употребления в пищу. Хотелось бы узнать мнение камрадов по поводу мяса хищников и некоторых других моментах.

Начну с крупняка. Не думаю, что стоит специально охотиться на данные виды, если есть что-либо другое, но коль уж добыл…
1. Медведь белый. Несъедобна печень (чревато отравлением витамином А). Насколько съедобны другие внутренние органы (почки, желудок) не знаю. Мясо требует хорошей термообработки (из-за опасности трихиннелёза).
2. Медведь бурый. Мясо, сердце, мозг считаются вполне съедобными, но также требуют термообработки (мясо лучше тушить или жарить — бульон может горчить). Насколько съедобны печень и почки — большой вопрос для меня.
3. Волк. Считается съедобным почти полностью, кроме желудка, печени и половых органов (поправьте, если не прав, инфы нарыл мало). Однако мясо его горьковато, жёсткое и со специфическим запахом. Но по пушнине пойдёт.

Морские звери. В принципе, съедобны все (есть сведения по поводу опасности печени тюленя из-за тяжёлого для переваривания жира и обилия витаминов).

Птицы. Насекомоядные и рыбоеды почти все съедобны (но можно травануться морскими в определённые времена года и в некоторых регионах, если те питаются моллюсками). Хищных птиц лучше обдирать, а не ощипывать. На счёт падальщиков типа грифов инфы почти нет, но вроде как несъедобны (да и связываться неохота — болячек много переносят). Чаек люди ели, когда дело до голода доходило, но опасное это дело (жрут они чё попало).

Из хищных моллюсков опасны тигровые и некоторые другие виды осминогов. Про остальных моллюсков информации много, но надо уметь различать, да и сезон и степень загрязнённости акватории обитания сильно влияет.

По морским рыбам инфы «на просторах» сети полно, а вот особенности поедания пресноводных более скромно описаны. На сайте был отличный материал про горькушку. Знаю об опасности сонной стерляди.

Следующий момент съедобность животных в зависимости от времени года и состояния. Хрестоматийные примеры — сонная стерлядь и мясо побегавшей ламы (последнее из Жюля Верна, жругих ссылок пока не нашёл) и волка.

Прошу камрадов дополнить мои извращённые измышления (особо ценю достоверный опыт — некоторые гугловые рецепты кажутся не совсем реальными, но, может, я и неправ).

Каждый начинающий охотник непременно проходит через искушение добыть и попробовать на вкус, что называется, не стандартную дичь. Например, многие стрелки, которые проживают вблизи крупных рек, озер или недалеко от морского побережья, часто задают вопрос о том, можно ли есть чаек. В народе на этот счет издавна существует множество поверий, но большинство из них связаны, главным образом, с религиозными мотивами, а не продиктованы практическими соображениями. Поэтому обязательно возникает соблазн поставить запрет под сомнение и проверить все на личном опыте.

Что говорят об этом традиции

Главная причина, по которой народная традиция запрещает убивать чайку, а уж тем более использовать ее мясо в пищу, заключается в том, что эта птица издревле считается символом душ усопших предков . Причем такое толкование характерно не только для славянских народов, у которых убийство чайки всегда считалось большим грехом. Такой же позиции придерживались и древние англичане – по их мнению, каждого, кто поймал чайку, в самое ближайшее время ждет несчастье. По этой причине даже моряки, что во время далеких плаваний испытывали нехватку провизии, избегали охоты на чаек.

Позднее, с концом языческой эпохи и началом христианства, подобный запрет перекочевал из устной традиции в Библию. Что же говорит главная книга верующих относительно того, можно ли есть чаек? Как в старом, так и в новом завете можно найти законы, которые регламентируют вопросы употребления животной пищи. В частности, мясо согласно данным правилам делится на чистое и нечистое. Нечистым считается мясо хищных, рыбоядных птиц, а также падальщиков, которые питаются трупами . Чайка попала в данный список по тому, что ее обычный рацион состоит не только из свежепойманной, но также и дохлой рыбы. Кроме того, чайки с удовольствием поедают ракообразных и других обитателей морей.

Прагматичный подход

Итак, религиозные уставы и народные традиции на вопрос о том, можно ли есть чаек, дают недвусмысленный отрицательный ответ . Но стоит ли к ним прислушиваться, ведь при желании можно привести сотни примеров, когда человечество отказывалось от прежних норм и обычаев ввиду изменившихся обстоятельств жизни. Может в отношении чаек тоже следует поступить подобным образом и пренебречь советами предков? Однако торопиться с такими выводами не стоит, так как древние люди вводили ограничения и создавали традиции не на пустом месте, и если они объявили чайку источником нечистого мяса, значит, у них на то были веские причины.

Прежде всего, нужно учитывать образ жизни данной птицы. Орнитологи не зря считают чайку самым эффективным санитаром береговой линии. Как говорилось выше, они не только ловят живую рыбу, но также употребляют в пищу мелких грызунов и даже падаль. Данное обстоятельство не сулит ничего хорошего человеку, который по какой-то причине решит отведать мясо чаек. В таких случаях существует высокая вероятность инфекционного заболевания, последствия которого для здоровья могут быть очень серьезными.

Дело в том, что организм чаек вырабатывает особого рода ферменты, которые обезвреживают опасные бактерии, попадающие в организм птицы с гниющим мясом. Это особенность и помогает чайкам переваривать падаль без каких-либо отрицательных последствий. Но у человека таких ферментов нет, поэтому для него употребление мяса чайки может оказаться весьма пагубным.

А каково оно на вкус?

Итак, мудрые предки и современные специалисты не рекомендуют есть чаек. Но при этом известно множество случаев употребления данной птицы в пищу. Правда, все они связаны с экстраординарными обстоятельствами, когда у человека не было иного выхода, и он был вынужден поступить таким образом ради сохранения собственной жизни. Какого же мнения были эти «счастливцы» относительно кулинарных характеристик мяса чаек?

Практически все, кому довелось так или иначе попробовать чаек, в один голос утверждают, что мясо их очень жесткое и лишено всякого вкуса . И если последнюю проблему можно решить, используя всевозможные приправы, пряности и т.д., то смягчить мясо чайки не поможет ни один известный способ. Маринование, отмачивание в уксусе и прочие кулинарные хитрости в данном случае просто бессильны – после любой самой тщательной и продолжительной обработки мясо сохраняет первоначальную жесткость и жилистость.

Итак, трудно найти хотя бы один веский довод, который помог бы положительно ответить на вопрос о том, можно ли есть чаек.

  • Во-первых , связываться с данной птицей не рекомендуют народные поверья и религиозные обычаи многих народов.
  • Во-вторых, мясо чайки представляет собой большую опасность с точки зрения инфекционных заболеваний.
  • В-третьих , это просто не вкусно.

Тем не менее, существуют определенные рецепты, которые практикуют в основном различные северные народы, такие как чукчи, инуиты и эскимосы. Приготовление блюд согласно этим рецептам в основном связано с ферментированием мяса животного под воздействием времени. В том числе для достижения особых вкусовых качеств используется фаршировка его туши мертвыми чайками.

Так, например, кивиак — тушу тюленя или моржа обезглавливают, фаршируют мертвыми чайками и закапывают на семь месяцев в вечную мерзлоту. Ферменты разлагающихся чаек приводят к своеобразным преобразованиям внутренностей животного, что придаёт конечному блюду вкус старого острого сыра. Кроме непосредственно чаек для этих целей используют еще и гагар.

О том, что вы думаете по поводу данного рецепта приготовления – пишите в

Внешний вид и особенности

Дикие птицы сносят в течение года лишь столько яиц, сколько необходимо для сохранения вида. У домашних птиц яйценоскость во много раз выше благодаря длительному искусственному отбору более яйценоских особей, соответствующему содержанию и кормлению.

Размеры яиц диких птиц зависят не только от размеров самой птицы, но и от образа жизни этих птиц. Например, у водоплавающих птиц яйца крупнее, чем у других птиц тех же размеров.

У разных видов диких птиц разная форма яйца, которая зависит от места, куда обычно данный вид птицы откладывает свои яйца. У диких птиц, устраивающих гнезда в ямках или лунках, круглая форма яиц. У птиц, гнездящихся на выступах скал, карнизах и т.д., яйца продолговатой формы.

Яйца диких птиц имеют различную окраску в зависимости от места гнездования. У птиц, которые устраивают гнезда в закрытых от чужих глаз местах, яйца, как правило, светлые. Яйца, откладываемые открыто, имеют чаще всего защитную окраску.

Интересные факты

Мировой лидер в потреблении яиц — Мексика. На одного жителя приходится полтора яйца в сутки.

Сегодня во многих европейских странах по особым разрешениям можно собирать яйца чаек — темные, пятнистые, зеленые или синие.

Применение

Яйца диких птиц первобытные люди собирали и ели в сыром виде задолго до того, как им удалось впервые одомашнить пернатых. Традиция эта не исчезла: во многих странах едят яйца дрозда, баклана, кайры, чайки, пингвина, куропатки, чибиса, зуйка, тупика, лебедя и многих других птиц. В Европе яйца диких птиц можно отведать разве что в дорогих ресторанах, но не во всех — в некоторых государствах употребление в пищу яиц диких птиц запрещено или ограничено. Во всех странах, не страдающих недостатком пищи и внимательно относящихся к дикой природе, сбор яиц диких птиц сейчас запрещен с несколькими исключениями.

Между тем гурманы утверждают, что яйца диких птиц обладают изысканным вкусом, не сравнимым с яйцами домашних птиц.

Яйца чаек с легким рыбным привкусом считаются деликатесом в Англии и Скандинавских странах, особенно в Норвегии. Во Франции особым деликатесом считаются яйца чибиса. Их варят вкрутую и используют в желе и салатах, в качестве закусок и гарниров.

Полезные свойства

Самое замечательное качество яиц диких птиц — это высокое содержание витаминов, макро- и микроэлементов. Витамины, содержащиеся в яйцах диких птиц, сохраняют здоровье волос, зубов и ногтей, помогают зрению, способствуют заживлению гнойных ран, укрепляют иммунитет и сосуды, снижают уровень холестерина, укрепляют нервы, предупреждают кожные болезни. Микро- и макроэлементы обеспечивают здоровье и крепость волос, ногтей и зубов, стимулируют умственную деятельность, прогоняют депрессию, укрепляют сердце и сосуды, помогают пищеварению. Считается, что яйца диких птиц омолаживают организм и являются афродизиаком.

Калорийность яиц диких птиц

Калорийность яиц диких птиц варьируется от 120 до 190 ккал в 100 г зависимости от вида птицы.

«Поганые» птицы — Троицкий вариант — Наука

Павел Квартальнов

Среди русских названий птиц есть имена, сложные для интерпретации, вызывающие порою ожесточенные споры среди филологов и орнитологов. А есть простые. Ну или представляющиеся таковыми. Известный пример «простого» слова — «поганка». Вот какое объяснение дает ему орнитолог Владимир Паевский: «Название „поганки“ эти птицы получили за неприятный вкус их мяса, пропахшего рыбой».

Казалось бы, что тут можно еще добавить? Остается только выразить сожаление, что одни из наиболее нарядных водоплавающих птиц получили столь обидное прозвище. Но почему именно поганки так «поплатились» за свои низкие гастрономические качества? Ведь существует немало менее съедобных птиц, а поганки как раз относятся к промысловым видам. В Предкавказье и Средней Азии поганок традиционно добывают на осеннем пролете.

Мне пришлось убедиться в этом во время осенней поездки на юг Калмыкии. Я ловил певчих птиц в тростниках, когда на озеро приехал местный рыбак — проверять свои сети. Он достал двух погибших птиц — почти не различающихся в осеннем наряде серощёкую поганку и чомгу. Бросив их на берег, рыбак снова ушел ставить сети. Дождавшись его возвращения, я начал выпрашивать птиц для зоологической коллекции. К моему удивлению, рыбак расставался с поганками неохотно. «Ты что, — говорил он мне, — знаешь, какие они жирные?! На сковороде пожаришь — лучше всякой рыбы. Ладно, бери меньшую», — добавил калмык. Мне того и надо было, я поблагодарил и удалился, сжимая в руках серощёкую поганку.

Согласно Михаилу Мензбиру, народное название «поганка» было распространено преимущественно в областях, где местное «инородческое» население (по Мензбиру — «татары») активно употребляло поганок в пищу, — в Оренбургской и Астраханской губерниях. На запад это слово доходило до Воронежской и Харьковской губерний, но туда его могли принести из восточных областей казаки.

Чомга

Академик Дмитрий Зеленин отмечал, что «русское „поганый“ значит собственно „языческий“, то есть нравственно нечистый». «Поганой», например, считали еду, оставшуюся после Масленицы с началом Великого поста. Таким образом, поганка не просто несъедобная птица, но птица, которую могут употреблять в пищу только «язычники». Считается установленным что само слово «поганый» пришло, в славянские языки от латинского paganus — сельский языческий (когда в городах преобладающей религией стало христианство сельские жители долго оставались язычниками). В научной литературе слово «поганка» стало общепринятым поскольку другие названия поганок (имевшие большее распространение в народе) такие как «нырок» («нырец») или «гагара» оказались закреплены за иными птицами.

Из общеизвестных славянских названий поганки пожалуй самое экзотическое — украинское «пырникоза» Это название принято интерпретировать буквально: «пiрнати» по-украински — «нырять» а «козою» большую поганку или чомгу , называли за узкие длинные , пучки перьев на голове напоминающие козьи рожки По предположению орнитолога Виталия Грищенко, малороссийское название чомги — всего лишь калька с польского perkoz. В польскую научную литературу слово perkoz как народное было введено в 1846 году выдающимся зоологом графом Константином Тызенгаузом (1786–1853), производившим его от выражения piórna koza, т. е. «пернатая коза», и использовавшим это слово для отличия поганок от прочих «нырков» (в первую очередь гагар).

Впрочем, по наблюдению польского филолога Анджея Баньковского, слово perkoz (как и его этимология) придумано самим Тызенгаузом. Таким образом, украинскую «пырни-козу» преждевременно считать иностранным заимствованием. В Польше чомгу чаще всего называли просто «козой» или «козулей». Кстати, про чомгу. Это слово русские заимствовали с тюркских языков, где «чомга» переводится как «нырок» и обозначает, кроме поганок, также других ныряющих водоплавающих птиц.

Баклан

Продолжая историю о несъедобных птицах, нужно сказать несколько слов о бакланах. «Баклан» — слово, похоже, заимствованное с тюркского, было распространено на юге России. Можно найти ссылки на то, что название «баклан» русские заимствовали у поволжских татар, обозначавших этим словом гусей. Есть искушение принять эту точку зрения. Большой баклан по размерам и пропорциям напоминает гуся, особенно в полете, и нередко охотники, принимая внезапно вылетающих на них бакланов за гусей, стреляют их.

Большой баклан

Несомненно, не только сейчас, но и в прежние времена происходили такие истории, когда радость от удачного выстрела сменялась разочарованием. Могло ли туземное слово войти в русский язык, поменяв смысловую окраску, вместо желанной вкусной птицы обозначить вонючую, заведомо несъедобную? Такие примеры известны, и по крайней мере один из них имеет отношение к птицам.

Из работы сотрудника Мордовского университета Михаила Сывороткина (2004) можно узнать о происхождении названия «мородунка» . В XIX веке так называли куликов-веретенников. Слово «мородунка» упоминает еще Владимир Даль, но удовлетворительное объяснение этому названию ни филологи, ни орнитологи долгое время предложить не могли. По наблюдению Сывороткина, в русских говорах на территории Мордовии есть слово «мородить», означающее «делать что-либо неумело, кое-как» либо «говорить вздор, пустомелить». Это слово ведет начало от финно-угорских «мор», «мора», «моро», обозначающих пение.

При переходе слова в русский язык изменилась его семантика, оно начало означать «плохое пение или не умение петь», а затем и вовсе «пусто словить, говорить ерунду». Именно за взбалмошный нрав, за пронзительные крики, с которыми веретенник носится над болотом при виде человека, он получил прозвище «мородунка». Сейчас «мородункой» мы называем другого мелкого куличка, живущего по топким берегам водоемов, его имя — наследие того времени, когда эту длинноклювую птицу считали близкой родственницей веретенников.

С бакланами всё же иная история. Внимательное знакомство со словарями показывает, что словом «баклан» татары называли не просто гуся, а огаря — ту самую красную утку, которая так знакома москвичам: по весне огари разлетаются из зоопарка по водоемам

Москвы и ближнего Подмосковья. В природе огарь гнездится в горах и степях, в том числе и на Нижней Волге. До сих пор «бакланом» огаря называют в Турции. Трудно предположить, что русские перенесли на черную рыбоядную птицу не название серого гуся, но имя такой нарядной птицы.

Между тем рыбоядных птиц называли «бакланами» издавна. В 1723 году в немецком Нюрнберге опубликован фолиант под громоздким названием «Новейшие государства Казань, Астрахань, Грузия и многие другие, царю, султану и шаху платившие дань и подвластные. Татарские земли и провинции вместе с кратким сообщением о Каспийском море, Дарьяльском ущелье, а также о персидском дворе и об их новейшем государственном и военном устройстве, написанное к присоединению русско-персидских военных действий и украшенное полезными гравюрами».

Автором этого труда считают немецкого путешественника и натуралиста Энгельберта Кемпфера (1651–1716), побывавшего в России и Персии в 1683–1684 годах. Описывая свои наблюдения на Нижней Волге, он подробно рассказывает про пеликана и баклана, причем последнего называет привычным нам словом. По описанию Кемпфера, баклан — птица крупнее утки, с длинной шеей и твердым круглым (в сечении) клювом, с крючком на конце, с жесткими черными перьями, по длине превышающими перья ворона; это водоплавающая птица, предпочитающая охотиться по ночам. Строки Кемпфера не обязательно свидетельствуют о том, что русские употребляли слово «баклан» еще в XVII веке. Кемпфер мог услышать это слово от персов. И в настоящее время в Иране баклана называют так же, как и в России. В этимологии персидского языка слово «баклан» считают тюркским заимствованием. К привычной нам птице оно относится издревле. Так, с демоном по имени Баклан мы неожиданно встречаемся в тайских легендах, где тот совершает ночное нападение из-под воды на обезьяну Ханумана и его спутников, остановившихся отдохнуть на берегу пруда.

Для окончательного решения вопроса о происхождении слова «баклан» необходимы знания в области тюркской филологии. Здесь же нужно уточнить, что «бакланами» обозначали самых разных птиц. В Турции и Иране этим словом порою называли дрофу, в низовьях Волги применяли к красноголовому нырку (впрочем, нельзя исключать, что это ошибка филологов, спутавших красноголового нырка и огаря), на Русском Севере «бакланами» называли сизых чаек или моевок, а «баклажкой» — обыкновенную гагу.

Можно предположить независимое происхождение некоторых из этих названий как звукоподражательных, соответствующих голосам птиц (в частности, огарей и чаек). Во всяком случае, схожее слово «баклага», обозначающее сосуд для воды с узким горлом, независимо от его происхождения (славянского или тюркского), наверняка звукоподражательное (имитирует звуки, с которыми вода выливается из такого сосуда). Хотя название гаги, скорее всего, связано с ее гнездованием или отдыхом на безлесных островах — «бакланах», « баклышах», « бакланцах», которым, в свою очередь, дали название гнездящиеся там же чайки.

«Неясыть» Птицы окрикивают сову

Нельзя рассуждать о названиях несъедобных птиц, не упомянув о происхождении слова «неясыть». В недавнее время слову дали любопытное толкование Игорь Лебедев и Владимир Константинов. Они обратили внимание на то, что это слово в русском языке обозначало не только сову, «но и самых разных птиц, включая пеликана, ворона и ястреба». Этот перечень довольно близко соответствует перечню птиц, запрещенных к употреблению по канонам Ветхого завета.

В 11-й главе Книги Левит (ст. 11–18) указано (согласно русскому синодальному переводу): «Из птиц же гнушайтесь сих (не должно их есть, скверны они): орла, грифа и морского орла, коршуна и сокола с породою его, всякого ворона с породою его, страуса, совы, чайки и ястреба с породою его, филина, рыболова и ибиса, лебедя, пеликана и сипа, цапли, зуя с породою его, удода и нетопыря». То есть «неясыть» — это «не еда», любая птица, которую не следует подавать на стол. Большинство перечисленных птиц относится к хищным, или рыбоядным, либо питаются по сорным местам, так что употребление их в пищу может привести к заражению опасными паразитами, поэтому запрет можно считать оправданным. Название «неясыть» явно содержит негативный посыл, поэтому неудивительно, что оно не прижилось как имя птиц, ставших символами силы и отваги (орлы и соколы), родительской заботы (пеликан), любви и супружеской верности (лебедь), и закрепилось за совами, чья жизнь для человека долго была окутана мраком ночи.

Это объяснение хотелось бы принять, если бы не единодушное мнение филологов, утверждающих, что слово «неясыть» означает «ненасытный» и изначально было связано с пеликаном. Внимательный поиск по литературным источникам подтверждает: народное название «неясыть», известное во многих славянских языках, относилось только к пеликану, остальные значения этого слова — книжного происхождения и порой имели весьма ограниченное применение: так «неясыть» заменяет дневную хищную птицу (по синодальному переводу — коршуна) только в одном из переложений Книги Левит.

Как же это слово от пеликана перешло на сову и других птиц? В cредневековой Руси были популярны своеобразные книги чудесных рассказов, переводившиеся с других языков. Эти книги пространно объясняли непонятные слова, встречающиеся в священных текстах, либо рассказывали о чудесных явлениях истолковывая их как притчи, в духе христианской веры. В этих книгах рассказана история о пеликане, оживлявшем погибших птенцов собственной кровью. Слово «пеликан» происходит от греческого pelikos, обозначавшего один из плотницких инструментов (разновидность тесака), схожий с длинным крючковатым клювом птицы. Христос был плотником поэтому неудивительно что пеликан стал олицетворять Христа.

Собственно в притче пеликан предстает как аллегория Христа искупившего грехи людей собственными страданиями. Альберт Великий (XIII век) пересказывая эту историю уточнял , что слово «пеликан» происходит от pelle cana («белый покров»). Благодаря этой этимологии пусть и ложной в некоторых рассказах смешались черты собственно пеликана и белого аиста. Вот как читалась история об аисте-пеликане («неясыти») в русском «Азбуковнике» XVII века: «Птица неясыть подобна журавлю по-славянски называется она стергом или буселем или же белым журавлем. Неясыть питается змиями. Чтобы сохранить детей своих от врагов — змий — неясыть вьет свое гнездо на высоких каменных скалах и деревьях Змеи в то время как неясыть оставляет птенцов своих не имея возможности вползти на скалу или дерево выбирают более удобное место прилегающее к гнезду неясыти Чаще всего змеи влезают на смежное с гнездом неясыти дерево и ждут, пока сильный ветер наклонит ветвь к гнезду.

Пеликан оживляет птенцов своей кровью

В это благоприятное для них время змеи выпускают из себя против ветра яд, который уносится ветром в гнездо и отравляет молодых птенцов. Родители последних, увидев, по возвращении своем, детей мертвыми, простирают над ними крылья, носом пробивают себе грудь и проливают на отравленных птенцов свою кровь, от которой они и оживают. Птица неясыть есть образ Христа. Птенцы — это мы, умерщвленные смертоносным жалом змия — диавола; биение неясыти в грудь и источение крови для оживления птенцов — это пробождение копьем ребра Христова и наше избавление от смерти — греха». В другой рукописи за рассказом «О неясыти», где в этой птице уже трудно узнать аиста, следует рассказ «О нощнем вране» (филине): «Рече Псаломник: „Бых яко нощный вран на нырищи“. Фисилог рече, птица си любит нощь паче дне, Господь же наш Иисус Христос люди возлюби ны во тьме седяще ны сени смертней, люди странныя, паче июдей, имже и сыновство от человек обещание приемшим, да тем Спас глаголаше: „Не бойся малое Мое стадо, яко благоволи Отец Мой дати вам Царствие небесное“ и прочее. Но речеши ми, яко нощный вран нечист по Закону. Добре апостол рече: „Не виде греха, законный грех сотвори“ и поубожися, да вся спасет и да вознесет. Добре рече Фисилог о нощнем вране».

«Нечистая» сова — образ грешника, чьи грехи не могут помешать ему принять веру в Христа и войти в Царствие небесное.

Рассказ о сове помещен за притчей о пеликане, и не случайно: такая последовательность связана с упоминанием обеих птиц в 101-м псалме Давида («Уподобихся неясыти пустынней, бых яко нощный вран на нырищи», — или в Синодальном переводе: «Я уподобился пеликану в пустыне; я стал как филин на развалинах…»). Переписчик этой рукописи из названий птиц понял только слово «вран» и на сопутствующих тексту миниатюрах изобразил пеликана и сову в виде воронов. Внимательный читатель в «нощнем вране» без труда узнавал сову, поэтому неудивительно, что образы двух птиц слились, и на «нощного врана» было перенесено имя «неясыть», которое не всегда удавалось соотнести с другой известной птицей.

Впрочем, посредство «Физиолога» могло и не потребоваться: достаточно было соседства «неясыти» и «нощного врана» в священных текстах. Окончательно слово «неясыть» было закреплено за совой в «Словаре Академии Российской», изданном в 1793 году, где о птицах писал, по-видимому, Иван Лепёхин. Там строки «уподобихся неясыти пустынней» отнесены к сове (натуралисту Лепёхину трудно было вообразить пеликана в безводной пустыне). В таком значении слово прочно вошло в светскую литературу. Если польская научная орнитонимия идет от Тызенгауза, то российская — от Лепёхина. И хотя церковно-славянские словари в XIX веке продолжали толковать библейскую «неясыть» как пеликана, они уже не смогли поправить ситуацию.

Павел Квартальнов,
канд. биол. наук, науч. сотр.
кафедры зоологии позвоночных
биологического факультета МГУ

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

См. также:

Птицы леса

Внешний вид. Спинная сторона серовато-голубая, крылья и хвост голубые, брюшко, голова, две широкие полосы на крыле и полосы по краям хвоста белые, через глаз проходит голубая или черная полоска.
Песня — короткая трель. Часто слышатся тонкое посвистывание и трелька, напоминающая голос свиристели, выкрики “тирр… тирр…” и тревожный резкий позыв “черпинк… черрпинк…” (похоже на позыв большой синицы).
Местообитания. Обитает в смешанных и лиственных лесах, чаще всего пойменных.
Питание. Питается насекомыми, зимой охотно ест различные семена.
Гнездование.
Гнездится в дуплах старых ив, ольх и других береговых деревьев, большей частью в самых непроходимых местах топких зарослей.

Подробнее…

 

Внешний вид. Короткохвостая, блестяще-черная птица , осенью и зимой в частых белых крапинках. К весне светлые кончики перьев стираются, и крапинки исчезают. Молодые птицы темно-бурые со светлым горлом. Типичная бегающая птица в отличие, например, от дроздов, передвигающихся прыжками. Полет прямолинейный.
Песня состоит из свистов, скрипов, подражаний другим птицам и различным шумам. Иногда в песне вернувшегося с зимовки скворца можно услышать голоса субтропических птиц. Крик — разнообразные мяукающие звуки, часто слышные из летящей стаи.
Местообитания. Обычен в редколесьях, степях и населенных пунктах. Предпочитает открытые культурные ландшафты с древесными насаждениями, парки и сады.
Питание. Питается различной животной и растительной пищей, по окончании периода гнездования собирается большими плотными стаями.
Места гнездования. Гнездится преимущественно у жилищ человека, занимая специально для скворцов сделанные и вывешенные искусственные гнездовья, ниши под балконами и крышами и т. п. Реже поселяется в дуплистых деревьях поблизости от населенных пунктов.

Подробнее…

 

Внешний вид. Заметно крупнее других голубей, 40 см в длину. На крыле, а у взрослых птиц также на боках шеи яркие белые пятна, клюв желтый, грудь розоватая, хвост снизу с белой поперечной полосой. При взлете громко хлопает крыльями.
Громкое трех-пятисложное гудение, передаваемое словами: “ни-ки-ту…ни-ки-ту…ви-дел…”
Местообитания. Живет в лесах, парках, на лесных опушках.
Питание. Питается семенами, нежными и сочными частями растений, ягодами, изредка гусеницами.
Места гнездования. Вяхирь — лесная птица. Гнездится в хвойных, смешанных и реже лиственных лесах.
Месторасположение гнезда. Гнездится на деревьях на высоте 1,5-30 м от земли. Гнездо размещает на основании толстой горизонтальной ветви, сплетении нескольких веток. Иногда занимает чье-либо старое гнездо, большей частью белки, вороны, сороки, мелких соколов.

Подробнее…

 

Внешний вид. Немного мельче голубя. Самцы и большинство самок имеют пепельно-серую окраску верха тела и головы и поперечнополосатую окраску низа (”ястребиного” типа). Некоторые самки имеют ржаво-рыжую окраску верхней стороны тела. Благодаря длинному хвосту (15-19 сантиметров) и крыльям (20-30 сантиметров) кукушка кажется более крупной птицей, особенно на лету, чем она есть на самом деле (вес ее всего 85-120 граммов). Молодые птицы отличаются от старых темно-бурой окраской верха тела, обычно с ржаво-рыжими поперечными полосами. На сгибе крыла есть белые перья с черными полосками. Хвост с белым кончиком, у рыжих самок — с темной полосой по краю.
Самец издает всем известное “ку-ку” (иногда трехсложное), порой переходящее в глухой хохот; для самки характерен звонкий крик “кли-кли-кли”. Кукушка редко кукует больше десяти раз подряд, поэтому спрашивать у нее, сколько лет вам осталось жить, не рекомендуется.
Местообитания. Обитает по всей стране от южных тундр до полупустынь в лесах, кустарниках, горных стланиках.
Питание. Питается кукушка различными насекомыми (уничтожает много волосатых гусениц, которых обычно не поедают другие птицы).
Гнездование. Подкладывает яйца в гнезда многих видов мелких воробьиных птиц. Самки относятся к нескольким наследственным линиям, каждая из которых связана с определенным видом-хозяином и откладывает яйца соответствующей окраски. Подросший кукушонок выкидывает из гнезда других птенцов, а их родители продолжают его кормить. В зависимости от региона птицы-хозяева могут быть разными. В Европе это прежде всего садовая горихвостка, сорокопут-жулан, славки и трясогузки. Период размножения — с мая по июль.

Подробнее…

 

Внешний вид. Крупный (с голубя ) длинноклювый коротконогий кулик, сверху рыжеватый с бурыми пестринами, низ серый с узкими поперечными пестринами. Голова, а у молодых и лоб, с черными поперечными полосами. Глаза большие, несколько сдвинуты к затылку. Крылья широкие. Скрытная ночная птица. Взлетает обычно молча.
В апреле для вальдшнепа очень характерен токовый полет — так называемая “тяга”, когда самцы, привлекая самку, медленно летают в сумерках над опушками, гарями, вырубками, лесными болотами с характерной ”песней”, состоящей из двух частей: вначале хриплое и довольно низкое хорканье “хоррр, хоррр, хоррр…”, которое некоторым слышится как “квоог, квоог, квоог…”, и затем чрезвычайно высокий, но мягкий свист — циканье.
Местообитания. Обитает в сырых лесах (чаще лиственных или смешанных), реже в лесостепях, на пролете и зимовках встречается в садах и парках, у незамерзающих ручьев и речек.
Питание. Питается, доставая из мягкой почвы дождевых червей и личинки.
Места гнездования. Гнездится исключительно в лесах. Наиболее характерными местами гнездования вальдшнепа в центральных областях нашей страны являются густые смешанные леса из сосны, ели, осины и березы, поросшие папоротниками и изобилующие валежником. Особенно предпочитает участки темного леса, изрезанные ручьями, оврагами, полянами с сырой почвой или же поблизости от сырых низин с богатым лиственным подлеском.

Подробнее…

 

Внешний вид. Примерно в полтора раза больше вороны , полностью черный с синеватым металлическим отливом, молодые птицы с чуть буроватыми концами крыльев. Клюв очень мощный. Хвост клиновидный ( в отличие от ворон и грача ), что особенно заметно в полете. Перья на горле заострены, птица то и дело их топорщит и реже машет крыльями в полете, чем другие врановые.
Громкое трубное гортанное ”крук”, разнообразное карканье, барабанные дроби.
Местообитания. В последние годы стал встречаться в населенных пунктах, где гнездится на высоких зданиях.
Питание. Питается как живой добычей (грызунами, птицами, яйцами и птенцами, лягушками, ящерицами), так и падалью. В Сибири, где народные поверья запрещают стрелять в ворона, он иногда сопровождает охотников или прилетает на звук выстрела, чтобы поживиться остатками добычи. Порой следует также за стаями волков.
Места гнездования. Гнездится в лесах разнообразного типа, по речным долинам. Не избегает и культурного ландшафта.

Подробнее…

 

Внешний вид. Птица размером чуть мельче голубя , коричневая (реже почти черная) в частых белых пестринах; верх головы, крылья и хвост черные; конец хвоста и надхвостье белые; клюв длинный, черный, чуть изогнутый книзу. Полет тяжелый, крылья короткие и очень широкие. Часто сидит на торчащих ветках или сухих верхушках деревьев.
Хриплое долгое “рээж” или “крэй”.
Местообитания. Обитает преимущественно в хвойных лесах.
Питание. Питается в основном семенами кедра, лещины, дуба. Для кедровки характерна привычка прятать в укромные места семена про запас. О большей части подобных “кладовых” птица потом не вспоминает, а семена впоследствии прорастают. Вероятно, без этих птиц не было бы большей части сибирских кедровников — ведь кедровые орешки, в отличие от семян других наших хвойных, не переносятся ветром.
Гнездование. Гнездится на деревьях или скалах. В кладке 4-5 зеленоватых с темными пятнами яиц.

Подробнее. ..

 

Внешний вид. Немного крупнее воробья, сверху буровато-коричневый, снизу буровато-серый, хвост довольно длинный, закругленный, одного цвета со спиной.
Песня — набор повторяющихся свистов и щелканий. Каждый элемент песни (колено), число которых может достигать 12, повторяется несколько раз. Крик — низкое “фюить-трр”.
Местообитания. Обитает в светлых лесах, поймах рек, садах и парках, обычно по сырым местам.
Питание. Питается насекомыми.
Места гнездования. Излюбленными местами гнездования соловья являются речные уремы, заросли кустарников по сырым лесным оврагам, тенистые кустарники среди лиственного леса, парки, рощи, сады, густые лиственные молодняки, заросшие кладбища и т. д. Пред почитает места, расположенные вблизи водоема или по крайней мере с сырой почвой.
Месторасположение гнезда. Гнездо устраивает обычно на земле у корней кустарника или древесной поросли, иногда в куче осенних сухих листьев. Располагает его не в ямке, как большинство гнездящихся на земле птиц, а на поверхности почвы, углубляясь лишь в лесную подстилку. При этом края гнезда находятся на уровне горизонта сухих листьев (иногда несколько выше) и переходят в него незаметно.

Подробнее…

 

Внешний вид. У самца голова, грудь и брюшко желтые с коричневатыми полосками, спина и пятна по бокам груди коричневые, по бокам хвоста белые полоски. Самки желтовато-бурые с каштановым надхвостьем.
Песня звонкое “зинь-зинь-зинь-зииииии…циик”, крик звонкое “цик”.
Местообитания. Живет на полянах, опушках, вырубках. Предпочитает открытые ландшафты, где имеются кусты и деревья; часто держится по обочинам дорог; избегает, как и все овсянки, чащу леса.
Питание. Питается преимущественно семенами растений, а также ягодами и насекомыми.
Места гнездования.
Любимыми местами гнездования овсянки являются разреженные участки леса, лесные поляны, молодая, преимущественно хвойная поросль, зарастающие лесные вырубки и опушки вблизи полей.

Подробнее…

 

9 альтернатив индейке, которые можно приготовить на День Благодарения

Турция, без сомнения, традиционная птица Дня Благодарения и один из знаковых символов Соединенных Штатов. Но это далеко не единственное блюдо, которое можно подавать гостям на большом празднике Благодарения, и далеко не самое вкусное.

Есть множество причин попробовать альтернативу индейке. Может быть, вы планируете ужин поменьше и вам не нужна гора мяса. Может быть, вам просто не нравятся эти вещи, как вечно очаровательная Зоуи Дешанель.Или, может быть, вы просто чувствуете, что застряли в колее.

Зачем соглашаться? Выйдите немного за пределы своей зоны комфорта и попробуйте один из множества видов птичьего мяса, которое может предложить планета Земля.

Гусь

Не менее величественно выглядят гуси на тарелке. [Кредит: Wikimedia Commons, «Алан Д. Уилсон»]

Рождественский окорок (или ханукальный окорок, для светских евреев среди нас), возможно, сделал гуся основным продуктом праздников в конце декабря, но нет причин, по которым гусь не может заменить Индейка благодарения.

Он намного богаче благодаря более толстому слою подкожного жира, но это означает, что он более ароматный и менее склонен к высыханию. (На самом деле, там так много жира, что в большинстве рецептов рекомендуется прокалывать птичью кожу, чтобы во время готовки вышел сок). Некоторые говорят, что гусиное мясо по вкусу напоминает хорошо прожаренный ростбиф. Подобно утке, мясо этой водоплавающей птицы темное и сочное, но технически это все же «белое мясо».

Предлагаемый рецепт: Поскольку это популярная птица с незапамятных времен, рецепты из гуся найти несложно.Тем не менее, нам действительно нравится дерзкий взгляд на жареного гуся в портвейне с рыжевато-коричневым соусом из портвейна Эмерил. Еще одно, что привлекло наше внимание, — это гусь, запеченный в перце и тимьяне, от скончавшегося шеф-повара из Чикаго Чарли Троттера.

Корнуоллская курица для дичи

Корнуоллские дичи не являются ни охотничьими птицами, ни курицей. Обсуждать. [Предоставлено: пользователь Flickr «Charkrem»]

Когда Фрэнк Костанца представил корнуоллскую курицу, он спросил: «Что это? Как маленький цыпленок?»

Хотя в то время его поправили, Фрэнк на самом деле здесь точно попадает в цель.«Дичная» курица — это не , на которую охотятся как на дичь, а на самом деле это гибридная курица, выращиваемая на фермах, как и другие куры. Поскольку он обычно продается целиком, этот маленький кусочек является идеальной заменой для пары, которая хочет уютно провести День Благодарения вдали от большой семьи.

Предлагаемый рецепт: В этом простом жареном изделии от A Spicy Perspective используются тимьян, розмарин и чеснок, чтобы дать этим маленьким птицам вкусный пинок.

Утка

Этот исключительно французский способ приготовления утки не рекомендуется на День Благодарения. Обратите внимание на фуа-гра поверх мяса. [Кредит: Wikimedia Commons, «PierreSelim»]

В отличие от большинства других птиц в этом списке, утку можно приготовить самыми разными способами. Фуа-гра, самый сомнительный с этической точки зрения заменитель птицы на День Благодарения в этом списке, вероятно, является самым роскошным вариантом для альтернативной толпы на День Благодарения. Утиная фуа-гра ( fois gras de canard ) немного дешевле, чем сопоставимый вариант гуся, но оба включают эмоциональный багаж, связанный с участием в процессе принудительного кормления, который многие считают жестоким.

Если вы предпочитаете уток без принудительного кормления, хорошая утиная грудка богаче и темнее, чем индейка. Как гусь и другие аквафильные птицы, он имеет толстый слой жира, который обеспечивает как вкус, так и богатую консистенцию. (Только убедитесь, что вы не покупаете магрет — грудку берберийской утки, подвергнутой принудительному вскармливанию.) Вы также можете попробовать более сложные приготовления, от конфи из утки до мясного рулета из утки.

Предлагаемый рецепт: Если вы хотите приготовить жареную утку, это пошаговое руководство от The Hungry Mouse — единственное, что вам нужно.(Не считая ингредиентов, конечно.)

Фазан

Фазан нравится. [Кредит: пользователь Flickr «lricharz»]

Да, вы можете купить фазанов.

Но давайте будем правдой: чтобы получить это абсолютное чувство самоудовлетворения, вам действительно нужна фотография, на которой вы держите их парочку, с дробовиком на боку и сияете от гордости. Независимо от того, как вы на самом деле пришли к ним, когда вы подаете своим гостям на День Благодарения такое необычное мясо, как фазан, вам лучше будет рассказать хорошую историю.

Фазан — относительно нежирное мясо, поэтому многие рецепты предлагают вам «смалеть» мясо во время его приготовления. По сути, это означает добавление к мясу лишнего жира, чтобы оно не высыхало; завернуть его в бекон или панчетту, кажется, является наиболее распространенным решением. После этого вы можете приступить к жарке, грилю или копчению птицы, как и любую другую птицу.

Мясо фазана часто описывается как обладающее «уникальным» вкусом, который, конечно, ничего не говорит вам о его вкусе.Мы подозреваем, что это что-то вроде курицы.

Предлагаемый рецепт: Эмерил любит жареного фазана, и мы любим рецепты Эмерила. Игра, сет, матч. Вот его любимый вариант жареного фазана с беконом, тимьяном и пудингом с лесными грибами.

Цесарка (Гвинейская курица)

Цесарка позирует папарацци. [Кредит: пользователь Flickr «mirabelka szuszu»]

Благодарение через пруд? Если вы находитесь в Южной Африке или Европе, цесарки (также известные как цесарки) плотно прилегают к земле, что делает их популярной целью для охотников на выходных.Здесь, в Штатах, они менее распространены, но вы все равно можете найти их в продаже у таких поставщиков мяса, как D’Artagnan.

Из-за их редкости в США они недешевы — к северу от 30 долларов за одну птицу. Но если вам нужен дополнительный кредит гурмана, вы будете выглядеть невероятно стильно, если подадите его своим гостям.

Предлагаемый рецепт: New York Magazine предлагает эту восхитительно звучащую комбинацию из фаршированных каштанами цесарок с жареным молодым картофелем с розмарином.Вот это и есть.

перепел

Перепел [Источник: Flickr user «SidPix»]

Перепел довольно маленький, то есть вы можете подать каждому за столом Благодарения свою птицу. Разовые ужины! Кому это не нравится?

Мясо перепела темное и сочное, и описывается как обладающее удивительно нежным ароматом для дичи. Если вам нравятся куриные и индюшачьи бедра, есть очень большой шанс, что вам понравится этот милый маленький наггетс.

Предлагаемые рецепты: Оба они звучали так хорошо, что мы не могли остановиться только на одном. В Eating Well рекомендуют обжаренную в духовке птицу, фаршированную имбирно-клюквенным пловом. PBS же предлагает перепелов по-итальянски с яблоками, лимонным соком и зеленью.

Голубь (Squab)

Несмотря на то, что его подают в элитных закусочных, голубь по-прежнему имеет клеймо грязной птицы. [Кредит: пользователь Flickr «stu_spivack»]

Нет, мы не предлагаем вам стоять в Центральном парке с сеткой.

В то время как молодые домашние голуби относительно распространены в элитной кухне, их обычно называют «косяками». Мясо темнее, чем у цыплят, оно ароматное и сочное, хотя их есть довольно неприятно, так как они маленькие и у них не так много мяса на птицу. Мясо имеет нежную консистенцию, и для оптимального вкуса его следует готовить средне-прожаренным.

Это особенный предмет, поэтому они не из дешевых, но, по общему мнению, сквоты феноменальны и их стоит попробовать.

Предлагаемый рецепт: Эта жареная каша с беконом и виноградом (через Food & Wine) звучит феноменально вкусно и легко в приготовлении. Нам также нравится это блюдо с белыми грибами и салатом из деревенского хлеба.

Куропатка

Настоящая семья куропаток наслаждается лугом. [Предоставлено: пользователь Flickr «Steenburgs»]

Перепел слишком мал? Фазан слишком большой? Попробуйте куропатку! Эти птицы не родом из Соединенных Штатов, но, как и большинство экзотических видов мяса, вы можете найти их в продаже, если присмотритесь.

Мясо куропатки нежирное и темное — очень похоже на фазана. Как и другие нежирные сорта мяса, его нужно готовить редко или медленно готовить в течение длительного времени, чтобы оно не стало жестким. Он описывается как имеющий более «землистый» вкус, чем курица, и нам говорят, что он исключительно хорошо сочетается с жареными грушами.

Предлагаемый рецепт: Рецепт жареной куропатки с жареной куропаткой по-французски, горохом и салатом по-французски звучит для нас феноменально!

Страус эму и страус

Страус определенно НЕ на вкус курицы.[Кредит: пользователь Flickr «p_a_h_»]

Хотя технически это домашняя птица, эти большие птицы имеют вкус, более похожий на красное мясо. Это делает их отличным выбором для людей, которым нужен мясной вкус без всего этого надоедливого жира и холестерина.

Мясо страуса и эму довольно постное, а это значит, что его лучше всего готовить путем быстрого обжаривания или жарения на гриле до средней прожарки, чтобы сохранить сочную текстуру. Вы можете приготовить их так же, как жаркое из говядины или свинины, или даже как стейки, и конечный результат также будет очень похож.Это хороший способ склонить упрямого родственника к более здоровому питанию.

Предлагаемый рецепт: Мы любим стейки и любим не умирать от сердечного приступа. Идеальное сочетание этих двух концепций — рецепт восхитительных стейков из страуса с соусом кальвадос.

Лебедь

Это единственные лебеди, которые должны быть на вашем столе. [Кредит: пользователь Flickr «Octal»]

… не вариант. Не ешьте лебедей; это не разрешено.

… но пусть это будет на твоей голове

Мы бы сказали, что это всего лишь наши два цента, но это явно в 500 раз важнее. Мы посчитали.

Отец-основатель Александр Гамильтон однажды высказал известное мнение, что «ни один гражданин Соединенных Штатов не должен отказываться от индейки в День благодарения». Все эти птицы могут быть восхитительными и супер модными, но вы действительно хотите разочаровать Алекса?

закусок для сценария выживания: поедание диких птиц и яйца

Пение диких птиц может быть музыкой для наших ушей, но если вы находитесь в ситуации выживания, они также могут быть колокольчиками к обеду.

На этой неделе мы собираемся обсудить сбор диких птиц и их яйца для пропитания. Практически все птицы съедобны. Однако когда дело доходит до вкуса, птиц можно сбить или пропустить. Однако, если вы когда-нибудь окажетесь в ситуации, когда вам придется полагаться на поедание птиц для выживания, вкус будет последней из ваших забот.

Как мы уже говорили в первой статье этой серии, охота за мясом — одна из последних вещей, которые вы должны делать в сценарии выживания (укрытие, огонь и добыча воды всегда должны быть на первом месте).Этот сценарий также предполагает, что вы отрезаны от остального мира, у вас почти нет припасов и нет возможности связаться со спасателями. Вы также можете прочитать наши руководства по поеданию насекомых и моллюсков здесь, рыб и земноводных здесь или рептилий здесь.

Дикие птицы

Выбор диких птиц для охоты и ловли сильно варьируется в зависимости от сезона и местоположения. Как и в случае с обычной охотой, стратегии поимки различных видов внутренних и водоплавающих птиц могут сильно отличаться.Есть также птицы, о которых вы обычно не думаете как о еде, например совы, чайки, бакланы и некоторые морские птицы. Все они съедобны, но традиционные дикие птицы, такие как перепел или индейка, могут дать более привычный вкус.

Считается, что птиц намного легче поймать, чем млекопитающих, хотя некоторые сложные ловушки довольно сложно построить. Если у вас по какой-то причине есть сетка, подумайте о создании «туманных сетей» или сетей, брошенных между деревьями на траекториях полета. Поскольку птицам сложно разглядеть сети или подобные предметы, животное бросится прямо в вашу ловушку и упадет на землю, где оно запутается в складках сети.Однако вам придется следить за этими ловушками, так как пойманные птицы могут быть быстро сожраны хищниками.

Еще одна популярная ловушка — ловушка для птиц оджибва. Вы можете узнать, как его собрать, из видео Дэйва Кентербери ниже:

Все дикие птицы — и почти все остальное — должны быть приготовлены перед употреблением. Если вам не хочется выплевывать перья при каждом укусе, вам следует ощипать птицу или снять с нее шкуру. Перед приготовлением откройте полость тела и удалите внутренности животного.Птиц также можно дергать для длительного хранения, просто оставив их сушиться на солнце. После обезвоживания мяса используйте камень, чтобы растолочь кости и открыть костный мозг, который также необходимо высушить, чтобы он не испортился.

Яйца

Как ни странно, яйца не часто упоминаются во многих руководствах по выживанию. Несмотря на это, яйца могут быть полноценным источником пищи, и мы говорим не только о птичьих яйцах. Съедобные яйца откладывают змеи, аллигаторы, черепахи и множество других животных.В крайнем случае можно есть даже рыбные яйца. Тем не менее, яйца может быть трудно найти, если вы не знаете, где искать, а птичьи яйца появляются только во время сезона гнездования. Они тоже очень маленькие. Домашние куриные яйца, к которым вы привыкли, по сравнению с ними покажутся огромными.

Некоторые виды птиц также можно обмануть, превратив в машины для яйцекладки. Если вам удастся найти гнездо и оставить птиц целыми и невредимыми, возьмите все яйца, кроме нескольких. Они откладывают еще, как только заметят, что некоторые, но не все яйца отсутствуют.

Следует также отметить, что, за исключением инвазивных видов птиц, изъятие яиц из гнезда диких птиц, как правило, является незаконным. С другой стороны, то же самое происходит и с добычей диких птиц вне сезона охоты и без разрешения, но это для гипотетического сценария выживания .

На следующей неделе мы поговорим о небольшой игре.

Вот почему съедобные гнезда из птичьей косы — деликатес в Китае

Крики любовных свифтлетов эхом разносятся по темной комнате, маловероятной золотой жиле для торговцев на юге Мьянмы, которые наживаются на растущем спросе на съедобные гнезда со стороны растущего среднего класса Китая.

Десятки зданий, посвященных крошечным птичкам, выросли вокруг Бокпина за последние годы, их серые бетонные конструкции возвышаются над скромными деревянными и кирпичными домами жителей города.

Каждое утро и вечер воздух наполнен пронзительным щебетанием, доносящимся из громкоговорителей, которые привлекают к себе домой тысячи ласточек-птиц.

Женщина катается на мотоцикле во время полета быстрых самолетов в поселке Бокпьин, регион Танинтари, на юго-востоке Мьянмы.(AFP)

Съедобные птичьи гнезда стали одной из основных отраслей промышленности в городе, который традиционно известен производством жевательного стимулирующего ореха бетеля, а также каучука и пальмового масла.

Торговцы могут взимать около 2000 долларов за визы (эквивалент 1,63 килограмма) за крошечные гнезда — больше, чем средний человек в Мьянме зарабатывает в год.

«Мы начали делать искусственные птичьи гнезда (домики) 10 лет назад», — сказал Пайнг Сет Аунг, владелец одного из зданий, где сотни свифтлетов строят свои дома на стропилах.

«Изначально это был дом, в котором птицы сами садились на ночлег. После этого люди начали строить искусственные скворечники ».

Swiftlets вьют гнезда на крыше здания в городе Миейк. (AFP)

Большинство крошечных белых гнезд, сделанных из затвердевшей птичьей слюны, продаются в соседний Китай. Они долгое время считались резервом богатой элиты страны, которая ела их во время пышных банкетов, и теперь они пользуются все большим спросом у потребителей среднего класса.

Сегодня мировая индустрия съедобных птичьих гнезд оценивается в 5 миллиардов долларов, большая часть из которых производится в Юго-Восточной Азии.

Экспорт Мьянмы резко вырос с 2011 года — года, когда бывшая хунта передала власть квазигражданскому правительству. «Птичьи гнезда — одно из основных предприятий в Бокпьине», — сказал местный Лин Аунг, построивший свой первый дом пять лет назад, а сейчас построивший третий. «Китай является основным покупателем птичьих гнезд здесь».

Икра Востока

Пройдя через границу, гнезда превращаются в один из самых дорогих продуктов питания в мире. При кипячении в воде они растворяются в студенистой слизи, которую затем превращают в десерты или пьют в виде супа или тоника, который, как говорят, продлевает жизнь и увеличивает силу.

Имеется мало рецензируемых научных данных, свидетельствующих о доказанных лечебных свойствах гнезд. Исследования питания показали, что слюна в основном состоит из белков, за которыми следуют углеводы.

В ресторанах Шанхая «икра Востока», как ее называют, продают по сотням долларов за тарелку.

Многие из них предназначены специально для женщин, которые считают, что гнезда могут помочь сгладить цвет лица и сделать их моложе. Утверждают, что тоник также помогает во время беременности — один из элитных спа-салонов Шанхая, предназначенный исключительно для будущих мам, даже имеет собственный ресторан и продает подарочные пакеты по цене до 566 долларов.

Покупатели также могут заказать товары через Интернет, в том числе засахаренные птичьи гнезда из Мьянмы, которые можно есть в качестве сладостей.

«В Китае птичье гнездо было действительно известным и очень любимым традиционным тонизирующим средством с древних времен», — сказала Чжан И AFP в своем ресторане NestCha. «Он мягкий и немного сладкий. Это хорошо для женщин, пожилых людей, детей и мужчин ».

Мужчина демонстрирует птичье гнездо, выловленное из свифтлеев, в поселке Бокпьин, регион Танинтари, на юго-востоке Мьянмы.(Ye Aung Thu / AFP)

Растущая промышленность

Эти предметы роскоши очень далеко от скромных зарослей на островах южного архипелага Мьянмы. Начнем с того, что они были собраны на многих островах региона отважными альпинистами, которые, рискуя жизнью и здоровьем, взбирались по опасным скалам без всякого защитного снаряжения.

В течение многих лет в отрасли доминировала компания Union of Myanma Economic Holdings Ltd (UMEHL), разросшийся конгломерат, контролируемый военной элитой, правившей Мьянмой на протяжении полувека.

Но, как и во многих странах Юго-Восточной Азии, производство все больше перемещается в городские центры. Местные жители в южном городе Миик начали строить дома, чтобы привлекать птиц несколько десятилетий назад, затем производство распространилось на Бокпьин и близлежащий Кавтаунг.

По данным государственных СМИ, в настоящее время по всему региону разбросано более 130 домов, посвященных свифтлеям. Конкуренция за места в Бокпине между производителями птичьих гнезд и застройщиками туризма привела к росту цен на землю до 75 000 долларов за участок в центре города — наравне с частями коммерческой столицы Янгона.

Гнезда обычно собирают три или четыре раза в год, но торговцы могут собирать их чаще одного раза в месяц, если им нужны деньги. Продюсер Аунг Чжо Мо сказал, что, поскольку популяция быстрых птиц естественным образом увеличивается по мере того, как птицы привыкают к своим домам, в ближайшие годы отрасль будет только расти.

«Они похожи на людей, потому что они приезжают сюда и живут здесь после того, как познакомятся с этим местом», — сказал он AFP, стоя рядом со своим высоким деревянным скворечником в Мейике.

Следуйте @htlifeandstyle, чтобы узнать больше

Съедобное птичье гнездо: разложение древнего лакомства

Возможно, вы слышали об этом, некоторые из вас, возможно, даже пробовали, но многие из нас, похоже, озадачены этим. Итак, что такое съедобное птичье гнездо, почему оно такое дорогое и есть ли научные данные, подтверждающие его пользу для здоровья?

Рекламы

Что в птичьем гнезде?

Название «птичье гнездо» вызывает в памяти образы веток и коры деревьев.Непосвященным трудно представить, как это вещество может (или даже почему это должно) попадать в организм в виде напитка или супа, не говоря уже о том, как такое вещество может принести пользу здоровью потребителя.

Источник: digdeep1962

Чтобы лучше понять этот редкий деликатес, необходимо понять несколько основных вещей. Во-первых, гнездо взято у птицы, называемой свифтлет, обитающей в определенных частях Азии и Австралии. Стрижки, в отличие от большинства птиц, вьют гнезда, выделяя слюну.Слюна высыхает и затвердевает при контакте с воздухом, образуя гнездо, которое, конечно, съедобно. Другими словами, вы глотаете… птичий слюн.

Страх пропустить?

Зарегистрируйтесь, чтобы каждый вторник получать на почту подборку главных новостей этой недели.

Есть ли научные доказательства, подтверждающие его предполагаемую пользу для здоровья?

Похоже, что пользу съедобного птичьего гнезда для здоровья еще предстоит опровергнуть. Авторитетные источники — из исследований, проведенных в основном в Сингапуре и Малайзии — предполагают, что гнезда содержат значительное количество питательной ценности.Однако долгосрочные положительные физические эффекты еще предстоит всесторонне отслеживать. Другими словами, химический состав был проверен, и гнезда, похоже, обладают полезными свойствами, но последним шагом будет неоспоримое эмпирическое заключение, основанное на данных, полученных в результате длительного наблюдения.

Источник: lelong.com

На данный момент единственное негативное освещение касается методов выращивания — болезни могут возникать среди выращиваемых на фермах стрижей, когда они находятся в отдельных птичниках. Традиционные методы сбора гнезд вручную в здоровой экосистеме менее проблематичны, хотя есть очевидные вопросы устойчивости в этой практике.

Рекламные объявления

Преимущества для здоровья

Поставщик детоксикации и кислорода

Съедобное птичье гнездо содержит восемнадцать аминокислот, некоторые из которых не вырабатываются организмом естественным путем. Аминокислоты приносят много пользы для здоровья. Группы, присутствующие в птичьем гнезде, объединяются, чтобы увеличить скорость, с которой наш организм усваивает токсичные вещества. Они также стимулируют рост красных кровяных телец, которые необходимы для переноса кислорода по всему телу, выводя при этом углекислый газ.

Борется с хроническими заболеваниями, улучшает работу нервов и энергию

Микроэлементы, содержащиеся в птичьем гнезде, включают марганец (Mn), медь (Cu) и цинк (Zn), которые вместе обеспечивают мощный импульс для многих важных функций организма. Марганец необходим для поддержания нормальной работы нервов и мозга. Кроме того, он помогает организму формировать соединительные ткани и балансировать половые гормоны, а также способствует метаболизму жиров и углеводов, а также регулированию уровня сахара в крови. Медь играет жизненно важную роль в производстве энергии и красных кровяных телец.Он помогает поддерживать нервные клетки и регулировать иммунную систему. А цинк улучшает иммунитет и пищеварение. Он также служит сильным антиоксидантом, замедляя процесс старения, действуя как противовоспалительное средство. Он имеет множество терапевтических применений при хронических заболеваниях, таких как рак и болезни сердца.

Источник: wolfsoup

Усилитель иммунной системы

Считается, что съедобное птичье гнездо положительно влияет на печень и почки при регулярном употреблении в течение длительного времени.Он богат предварительно переваренным белком и питательными веществами, и употребление их в этой редкой форме может помочь организму бороться с болезнями и недугами. Фактически, по данным The Japan Times, птичье гнездо в настоящее время проходит испытания на предмет потенциальной защиты от ВИЧ.

Лучшая кожа

Это утверждение, вероятно, связано с наиболее убедительными исследованиями. С положительным эффектом сложно поспорить. Он содержит антивозрастные и противоугревые агенты, а также увеличивает количество коллагена и эластина из-за высокого уровня галактозы и треонина.В сочетании с глицином эти элементы могут предотвращать появление морщин, поддерживать восстановление клеток кожи и уменьшать образование пигментных пятен, уступая место более сбалансированному цвету лица.

Другие преимущества

К другим преимуществам для здоровья относятся следующие: повышение аппетита, улучшение пищеварения, профилактика простуды и гриппа, регенерация клеток и восстановление хрящей. Он также высоко ценится как полезная добавка для беременных.

Почему так дорого?

Пожалуй, наиболее важным фактором, влияющим на стоимость съедобного птичьего гнезда, является его редкость.Птицы — обитатели пещер и часто строят свои гнезда в высоких пещерах из известнякового карста, что делает процесс их извлечения чрезвычайно опасным. Фуражиры — это часто люди из горных районов, которые не используют современное альпинистское снаряжение, что делает эту работу чрезвычайно рискованной. Процесс сбора урожая также требует много времени и требует бесчисленных часов ручного труда.

Рекламы

Как потребляют съедобные птичьи гнезда?

Сначала нужно очистить птичье гнездо.По словам одного местного эксперта, Hai Duong , каждое отдельное гнездо может содержать десятки тысяч насекомых, которых перед распределением необходимо ощипать вручную.

Источник: dannyfangbirdnest

Птичье гнездо употребляют в пищу в Китае не менее 400 лет, чаще всего в виде супа. Однако его также можно подавать как студенистый десерт или напиток. Его часто смешивают с сахаром из-за мягкого вкуса. Во Вьетнаме его в основном употребляют в виде напитка или съедобного экстракта, а не в виде супа или десерта.

В связи с тем, что он исторически ценился за его свойства улучшения кожи, предотвращения морщин и других улучшающих кожу эффектов, неудивительно, что он недавно появился на рынке косметики, и его можно найти в различные элитные косметические товары, особенно в таких странах, как Корея и Япония. Фактически, было высказано предположение, что в этой тенденции нет ничего нового. По легенде, гейши доходили до того, что даже мазали лицо птичьим пометом, чтобы улучшить свою кожу.

Сколько это Вьетнам?

Съедобное птичье гнездо остается одним из самых дорогих гастрономических предметов на планете. В зависимости от сорта гнезда и от того, предпочитаете ли вы покупать его в сыром виде, в качестве питьевой жидкости или в качестве еды, цена будет сильно различаться. Самый высокий доступный сорт имеет чистоту 90%, и его можно есть сразу после сбора урожая. При покупке в сыром виде один килограмм высококачественного птичьего гнезда может стоить 5000 долларов США, но в среднем один килограмм в настоящее время продается примерно за 2500 долларов США.

Предоставлено InterContinental Hong-Kong / Flickr

Однако вы можете купить его в небольших количествах, что делает его более доступным. Средняя цена на двухмесячный 100-граммовый тайник будет стоить примерно 150-200 долларов США за гнездо среднего класса. Если вы пьете его каждый день, это означает, что вы будете тратить около 3 долларов США в день. Когда вы смотрите на это с этой точки зрения, в конце концов, это не должно казаться таким значительным вложением средств.

Рекламные объявления

Остерегайтесь подделок

Да, по всему миру продается бесчисленное множество подделок во многих формах.Как и в случае с любым другим высококачественным потребительским товаром, вы изучаете и знаете, что покупаете. Познакомьтесь с поставщиком и найдите того, которому вы доверяете. Если это дешево, вы можете гарантировать, что это либо подделка, либо количество настоящего птичьего гнезда настолько мало, что его польза для здоровья ничтожна.

Знайте факты

Экологические факторы

Рост международного спроса на этот деликатес, несомненно, нанес ущерб популяции быстрых животных, которая сейчас находится на грани исчезновения.Происходит чрезмерный сбор урожая, и наблюдается рост использования неорганических методов земледелия. Это привело к желанию регулировать рынок, но пока не набрало обороты.

Когда употреблять

Имейте в виду, что большинство экспертов считают, что для того, чтобы воспользоваться преимуществами съедобного птичьего гнезда, его нужно употреблять в течение длительного времени. И его не следует употреблять чаще одного раза в день, так как организм не может усвоить такое количество питательных веществ за такой короткий период времени. Многие говорят, что лучше всего есть птичье гнездо утром натощак, чтобы максимально увеличить способность организма усваивать питательные вещества.

Сколько употреблять

Специалисты рекомендуют 2 грамма сушеного птичьего гнезда или 60-80 миллилитров жидкости в день.

Рекламные объявления

Наше заключение

Похоже, что питательная ценность птичьего гнезда бесспорна, но, как и при приеме других витаминов и добавок, это имеет свою цену. Когда вы делаете вычисления, если брать в ограниченных количествах, птичье гнездо должно быть в рамках бюджета. Помните, эксперты говорят, что принимать его нужно постоянно, поэтому не ждите, что какие-либо преимущества появятся немедленно.И, конечно же, как и во всем остальном в жизни, единственный способ узнать наверняка — это попробовать это на себе.

Галлоуэй: Голуби — съедобные птицы

Бетти Х. Галлоуэй
Автор Hottytoddy.com

Я была типичной южной невестой, которая была достаточно наивной, чтобы думать, что в 20 лет я готова к трудностям и обязанностям по ведению домашнего хозяйства. После свадьбы мы переехали в студенческую квартиру в кампусе Оле Мисс, куда был зачислен мой муж.Как и у других женатых студентов, наше скудное имущество состояло в основном из стола и стульев, кровати, дивана, а также посуды, кастрюль и сковородок для свадебных подарков. У нас не было денег, чтобы добавить больше вещей, и даже покупать продукты приходилось очень осторожно, чтобы наши доллары растягивались до моей зарплаты каждый месяц. Я изучил основы приготовления простых вещей, таких как картофельное пюре, жареный цыпленок и иногда жаркое в горшочке, поэтому мы никогда не голодали, но иногда это было близко

Однажды в пятницу вечером зашел мой муж и объявил, что на следующий день его пригласили на охоту на голубей.Я никогда не видел голубя и искоса смотрел на него. Он объяснил, что голубь — это съедобная птица и что на следующий вечер он подстреляет часть нашего ужина (в те дни мы не использовали слово обед). Тогда я был взволнован тем, что для разнообразия у нас будет необычный и другой обед. Когда на следующий день он ушел на охоту, я прибралась в квартире и начала готовить остальную еду из тех немногих вещей, которые у нас были под рукой. Но была одна проблема — я не умела варить голубей, потому что не знала эту птицу.

Я решил воспользоваться испытанным методом — позвонил свекрови. Сначала я сказал ей, что ее сына пригласили на охоту на голубей, а ее и моего тестя пригласили поужинать с нами в ту ночь. Она любезно приняла приглашение. Тогда я спросил ее, как приготовить голубей. Она объяснила, что после того, как они будут очищены, я должна завернуть каждую птицу в бекон и закрепить ее зубочисткой. Она спросила, есть ли у меня голландская печь. Я сказал ей, что нет, но что у меня есть железная сковорода с крышкой, и она согласилась, что сковорода подойдет.Она посоветовала мне положить каждого голубя, завернутого в бекон, на дно сковороды, покрыть каждую птицу соевым соусом, добавить воды, достаточной для образования пара, и готовить в горячей духовке, пока бекон не станет коричневым. Это звучало достаточно просто.

Фото через Pixabay.

Мой муж пришел домой поздно вечером и протянул мне сумку с голубями. Он пошел в гостиную смотреть телевизор, а я пошел на кухню. Все остальное к ужину было готово. Я опустошил сумку и начал чистить голубей.Когда я щипал голубя, крошечные пушистые перья начали парить в воздухе, и я отчаянно пытался их поймать. Несмотря на все, что я могла сделать, некоторые из них поплыли в гостиную, где мой муж обдумал, и побежал на кухню, где я старательно пыталась вырвать все перья у голубя, который держал в руке. «Нет, нет, нет», — сказал он. «Вы просто снимаете с них шкуру; выбросьте кожу, перья, крылья и ноги. Мы едим только грудь! »

Он казался немного взволнованным, но я знал, что он устал после дневной охоты.Он вернулся к своему телевизору, и я выполнила задание «раздеть» голубей, приготовила их, как велела свекровь, и поместила в духовку. Когда я закрывал дверцу духовки, в нашу дверь постучали. Я вышла из кухни, когда мой муж открыл дверь, чтобы поприветствовать своих родителей. Шок на его лице, должно быть, был для них очевиден, и моя свекровь заговорила: «Нас пригласили на ужин с голубями!» Я понял, что у меня не было возможности сказать ему, что его родители идут поесть, но чем краснее становилось его лицо, тем больше я понимал, что мне нужно кое-что объяснить.Мы немного поговорили, когда я накрыл на стол и разложил все, что приготовил. Наша квартира была очень маленькой, и у меня была хорошая публика, когда я вынул сковороду из горячей духовки, осторожно поднял крышку и присоединился к ним троим, когда мы заглянули в сковороду и увидели красиво подрумяненный бекон на двух мячах для гольфа . размер голубиной груди. Воцарилась мертвая тишина, прежде чем разразился смех. Я был настолько наивен, что думал, что голубиные грудки вырастут до размеров петуха Доминекера в процессе приготовления.Я был огорчен, но что мне делать? Я знал, что в кухонном шкафу есть только один предмет.

В ту ночь свекровь и тесть ужинали голубями, а мы с мужем ели ломтики жареного спама.

В течение следующих 47 лет слово «голубь» было запрещено в нашем доме.

Влияние съедобного птичьего гнезда (EBN) на культивируемые кератоциты роговицы кролика | BMC Дополнительная медицина и терапия

  • 1.

    Lu L, Reinach PS, Kao WWY: Заживление эпителиальных ран роговицы.Exp Biol Med. 2001, 226: 653-664.

    CAS Google Scholar

  • 2.

    Krachmer JH, Mannis MJ, Holland EJ: Роговица: основы роговицы и внешних заболеваний. 2004, издание Mosby-Year Book, 183–195.

    Google Scholar

  • 3.

    West-Mays JA, Dwivedi DJ: Кератоциты: стромальные клетки роговицы с различными фенотипами репарации. Международный журнал биохимии и клеточной биологии.2006, 38: 1625-1631.

    CAS Статья Google Scholar

  • 4.

    He J, Bazan HEP: синергизм эпидермального фактора роста с TGF-β1 через активность киназы PI-3 в дифференцировке кератоцитов роговицы. Инвестируйте Opthalmol Vis Sci. 2008, 49 (7): 2936-2945.

    Артикул Google Scholar

  • 5.

    Fini ME: Фенотипы кератоцитов и фибробластов в восстанавливающейся роговице. Prog Retin Eye Res.1999, 18 (4): 529-551.

    CAS Статья PubMed Google Scholar

  • 6.

    Пул К.А., Брукс Н.Х., Кловер Г.М.: Сети кератоцитов, визуализированные в живой роговице с использованием жизненно важных красителей. J Cell Sci. 1993, 106: 685-692.

    PubMed Google Scholar

  • 7.

    Дэвисон П.Ф., Гэлбави Э.Дж.: Ремоделирование соединительной ткани в ранах роговицы и склеры. Инвестируйте Ophthalmol Vis Sci.1986, 27: 1478-1484.

    CAS PubMed Google Scholar

  • 8.

    Jester JV, Petroll WM, Cavanagh HD: Заживление стромальных ран роговицы в рефракционной хирургии: роль миофибробластов. Prog Retin Eye Res. 1999, 18: 311-356.

    CAS Статья PubMed Google Scholar

  • 9.

    Fini ME, Streamer BM: Как заживает роговица: механизмы восстановления роговицы, влияющие на хирургические результаты.Роговица. 2005, 24: 2-11.

    Артикул Google Scholar

  • 10.

    Gnanadoss AS: Руководство по роговице. 2008, Jaypee Bros. Medical Publishes (P) Ltd, 62-64.

    Книга Google Scholar

  • 11.

    West-Mays JA, Dwivedi DJ: Кератоциты: стромальные клетки роговицы с различными фенотипами репарации. Международный журнал биохимии и клеточной биологии. 2006, 38: 1625-1631.

    CAS Статья Google Scholar

  • 12.

    Уилсон С.Е., Нетто М., Амбросио Р.: Клетки роговицы: болтовня в развитии, гомеостаз, заживление ран и болезнь. Am J Ophthalmol. 2003, 136 (3): 530-536.

    Артикул PubMed Google Scholar

  • 13.

    Dayhaw-Barker P: Заживление ран роговицы II: Процесс. ICLC. 1995, 110–116. 22

  • 14.

    Bartleh JD: Факты о офтальмологических препаратах.2009, Wolters Kluwer Health, 20

    Google Scholar

  • 15.

    Коллин HB: Ультра структурные изменения стромальных клеток роговицы из-за офтальмологических консервантов. Acta Ophthalmologica. 1986, 64 (1): 72-78.

    CAS Статья PubMed Google Scholar

  • 16.

    Kong YC, Keung WM, Tip TT, Ko KK, Tsao SW, Ng MH: Доказательства присутствия эпидермального фактора роста в гнезде Swiflet (Collocalia).Сравнительная биохимия и физиология. 1987, 87 (2): 221-226.

    CAS PubMed Google Scholar

  • 17.

    Ng MH, Chan KH, Kong YC: Усиление митогенного ответа экстрактами гнезда свифтлета (Collocalia). Biochem Int. 1986, 13: 521-531.

    CAS PubMed Google Scholar

  • 18.

    Яно С., Кондо К., Ямагути М., Ричмонд Г., Хатчисон М., Вакелинг А., Авербух С., Уодсворт П.: Распределение и функция EGFR в ткани человека и эффект ингибирования тирозинкиназы EGFR.Anticancer Res. 2003, 23: 3639-3650.

    CAS PubMed Google Scholar

  • 19.

    Чжан М., Ван Д., Ван Дж .: Влияние экстрактов Чжэньчжу-Янво на функции животных. Фарм Биотех. 1994, 1: 49-51.

    CAS Google Scholar

  • 20.

    Гуо С., Такахаши Т., Букава В., Такахаши Н., Яги Н., Като К., Хидари К.И.-Пи-Джей, Миямото Д., Сузуки Т., Сузуки Ю. Экстракт съедобного птичьего гнезда подавляет заражение вирусом гриппа.Противовирусные исследования. 2006, 70: 140-146.

    CAS Статья PubMed Google Scholar

  • 21.

    Асвир А.Р., Ван Назаймун В.М.: Влияние съедобного птичьего гнезда на пролиферацию клеток Caco-2. Журнал пищевых технологий. 2010, 3: 126-130.

    Google Scholar

  • 22.

    Ода М., Охта С., Суга Т., Аоки Т.: Исследование пищевых компонентов: структура N-связанного азиалоуглевода из съедобного птичьего гнезда, построенного Collocalia fuciphaga.Журнал сельскохозяйственной и пищевой химии. 1998, 3047-3053. 46

  • 23.

    Norzana AG, Ropilah AR, Jemaimah C, Chua KH, Fauziah O, Aminuddin BS, Ruszymah BHI: Лимбальные эпителиальные клетки кроликов сохраняют свою стволовость в системе культивирования без сыворотки и без питающего слоя. Тканевая инженерия и регенеративная медицина. 2007, 4: 557-565.

    Google Scholar

  • 24.

    Нур Фариха М.М., Чуа К.Х., Тан Г.К., Тан А.Е., Хаяти А.Р.: Стволовые клетки, полученные из хориона человека: изменения свойств стволовых клеток во время серийных пассажей.Цитотерапия. 2011, 13 (5): 582-593.

    CAS Статья Google Scholar

  • 25.

    Woo HM, Kim MS, Kweon OK, Kim DY, Nam TC, Kim JH: Влияние амниотической мембраны на заживление эпителиальной раны и ремоделирование стромы после эксимер-лазерной кератэктомии в роговице кролика. Br J Ophthalmol. 2001, 85: 345-349.

    CAS Статья PubMed PubMed Central Google Scholar

  • 26.

    Шиммура С., Шимазаки Дж., Охаши Ю., Цубота К.: Противовоспалительные эффекты трансплантации амниотической мембраны при заболеваниях глазной поверхности. Роговица. 2001, 20: 408-413.

    CAS Статья PubMed Google Scholar

  • 27.

    Meller D, Pauklin M, Thomasen H, Westekemper H, Steulh K: Трансплантация амниотической мембраны в человеческий глаз. Dtsch Arztebl Int. 2011, 108 (14): 243-248.

    PubMed PubMed Central Google Scholar

  • 28.

    Иманиши Дж., Камияма К., Игучи И., Кита М., Сотозоно С., Киношита С.: Факторы роста: важность для заживления ран и поддержания прозрачности роговицы. Prog Retin Eye Res. 2001, 19 (1): 113-129.

    Артикул Google Scholar

  • 29.

    Панчоли С., Толлу А., Халик А., Форман Д., Боултон М.: Влияние факторов роста и кондиционированных сред на пролиферацию эпителиальных клеток роговицы человека и кератоцитов. Архив клинической и экспериментальной офтальмологии Грефе.1998, 236 (1): 1-8.

    CAS Статья Google Scholar

  • 30.

    Qin P, Kurpakus MA: Роль ламинина-5 в TGF-альфа / EGF-опосредованной подвижности эпителиальных клеток роговицы. Exp Eye Res. 1998, 66 (5): 569-579.

    CAS Статья PubMed Google Scholar

  • 31.

    Heather CB, Marshall J: Факторы роста при заживлении ран роговицы после рефракционной хирургии: обзор.Acta Ophthalmologica. 2002, 80 (3): 238-247.

    Артикул Google Scholar

  • 32.

    Коломбо Дж. П., Гарсия-Роденас С., Гезри П. Р., Рей Дж.: Возможные эффекты добавок с аминокислотами, холином или сиаловой кислотой на когнитивное развитие младенцев. Acta Paediatrica. 2003, 92: 42-46.

    CAS Статья PubMed Google Scholar

  • 33.

    Дхаван С., Кухад Р.С.: Влияние аминокислот и витаминов на производство лакказы грибком птичьего гнезда.Cyathus bulleri Bioresour Technol. 2002, 84: 35-38.

    CAS Статья PubMed Google Scholar

  • 34.

    Сэм CT, Тан PH, Лим CH: Установление подлинности съедобного птичьего гнезда. Научный обзор медицины ISFM. 1991, 3: 1-4.

    Google Scholar

  • 35.

    Kathan RII, Weeks DI: Структурные исследования мукоида коллокалии. I. Углеводный и аминокислотный состав.Arch Biochem Biophys. 1969, 134: 572-576.

    CAS Статья PubMed Google Scholar

  • 36.

    Котран Р.С., Кумар В., Фаусто Н., Роббинс С.Л., Аббас А.К.: Патологические основы болезни Роббинса и Котрана. 2005, Эльзевьер Сондерс

    Google Scholar

  • 37.

    Андресен Дж. Л., Ледет Т., Эларс Н.: Миграция кератоцитов и факторы роста пептидов: влияние PDGF, bFGF, EGF, IGF-I, aFGF и TGF-β на миграцию кератоцитов человека в коллагеновом геле.Curr Eye Res. 1997, 16: 605-613.

    CAS Статья PubMed Google Scholar

  • 38.

    Панчоли С., Талло А., Халик А., Форман Д.: Влияние факторов роста и кондиционированных сред на пролиферацию эпителиальных клеток роговицы человека и кератоцитов. Арка Грефе Clin Exp Opthalmo. 1998, 236: 1-8.

    CAS Статья Google Scholar

  • 39.

    Nardone RM: Методология культивирования клеток от донора до клеточных линий.Биотехнологии. 1987, 5: 122-127.

    CAS Google Scholar

  • 40.

    Батлер М., Дженкинс Х: Питательные аспекты роста клеток животных в культуре. J Biotechnol. 1989, 12: 97-110.

    CAS Статья Google Scholar

  • 41.

    Freshney RI: Культура клеток животных: Руководство по базовой технике. 1994, Нью-Йорк: Wiley-Liss, Inc, 3

    Google Scholar

  • 42.

    Мизрахи А., Лазар А. Среда для культивирования клеток животных: обзор. Цитотехнология. 1988, 1: 199-214.

    CAS PubMed Google Scholar

  • 43.

    Барнс Д., Сато Г.: Бессывороточная культура клеток: объединяющий подход. Клетка. 1980, 24: 649-655.

    Артикул Google Scholar

  • 44.

    Masters JRW: Культура клеток животных. Практический подход. 2000, Oxford University Press, 3

    Google Scholar

  • 45.

    Дэвис Дж. М.: Базовая культура клеток. Практический подход. 2002, Oxford University Press, 2

    Google Scholar

  • 46.

    Далили М., Оллис Д.Ф.: временная кинетика роста гибридомы и продукция моноклональных антител в культурах с ограничением по сыворотке. Eiotechnol Bioeng. 1989, 33: 984-990.

    CAS Статья Google Scholar

  • 47.

    Glacken MW, Adema E, Sinskey AJ: Математические описания кинетики гибридомной культуры.II. Взаимосвязь между химией тиолов и деградацией активности сыворотки. Biotechnol Bioeng. 1989, 33: 440-450.

    CAS Статья PubMed Google Scholar

  • 48.

    Lee GM, Huard TK, Palsson BO: Влияние концентрации в сыворотке на рост гибридомных клеток и продукцию моноклональных антител при различных исходных плотностях клеток. Гибридонто. 1989, 3: 369-375.

    Артикул Google Scholar

  • 49.

    Циммерманн Д. Р., Треуб Б., Винтерхальтер К. Х., Витмер Р., Фишер Р. В. Коллаген типа VI является основным компонентом роговицы человека. FEBS (Fed Euir Biochem Soc) Lett. 1986, 197: 55-58.

    CAS Статья Google Scholar

  • 50.

    Махин А., Тилли П., Элизабет М.А., Роджер С.Х .: Альдегиддегидрогеназа роговицы крупного рогатого скота: основной растворимый белок роговицы с возможной двойной защитной ролью для глаза. Экспериментальные исследования глаз. 1990, 51 (4): 419-426.

    Артикул Google Scholar

  • 51.

    Kao WW, Liu CY: Роль люмикана и кератокана в прозрачности роговицы. Glycoconj J. 2002, 19 (4-5): 275-285.

    CAS Статья PubMed Google Scholar

  • Съедобное птичье гнездо предотвращает резистентность к инсулину, вызванную высоким содержанием жиров у крыс

    Съедобное птичье гнездо (EBN) традиционно используется во многих частях Азии для улучшения самочувствия, но есть ограниченные исследования его эффективности.Мы исследовали потенциальное использование EBN для предотвращения инсулинорезистентности, вызванной диетой с высоким содержанием жиров (HFD-), у крыс. HFD давали крысам с симвастатином или EBN или без них в течение 12 недель. Во время периода вмешательства измерения веса регистрировались еженедельно. В конце вмешательства были собраны образцы крови и проведен пероральный тест на толерантность к глюкозе, после чего крыс умерщвляли, а их печень и жировую ткань собирали для дальнейших исследований. Были оценены сывороточный адипонектин, лептин, F2-изопростан, инсулин и липидный профиль, и рассчитана гомеостатическая модель оценки инсулинорезистентности.Также оценивали влияние различных вмешательств на регуляцию транскрипции сигнальных генов инсулина. Результаты показали, что HFD ухудшает метаболические индексы и индуцирует инсулинорезистентность частично за счет регуляции транскрипции сигнальных генов инсулина. Кроме того, симвастатин был способен предотвращать гиперхолестеринемию, но способствовал развитию инсулинорезистентности, аналогичной HFD. EBN, с другой стороны, предотвращает ухудшение показателей метаболизма и транскрипционные изменения сигнальных генов инсулина из-за HFD.Результаты показывают, что EBN можно использовать в качестве функциональной пищи для предотвращения инсулинорезистентности.

    1. Введение

    Растущее бремя кардиометаболических заболеваний, даже несмотря на прогресс в медицине, является движущим фактором повышенного интереса к альтернативным методам лечения этих заболеваний и связанных с ними проблем [1, 2] . Кроме того, рост показателей ожирения во всем мире из-за факторов нездорового образа жизни способствует развитию этих тенденций к увеличению заболеваемости; ожирение способствует инсулинорезистентности и, в конечном итоге, кардиометаболическим заболеваниям [3].Фактически, по оценкам, если люди с риском инсулинорезистентности и кардиометаболических заболеваний будут точно определены с использованием чувствительных диагностических методов, количество тех, кто нуждается в вмешательствах для управления своим состоянием, будет намного выше установленных цифр [4]. Существуют различные теории, используемые для предположения основных механизмов, вовлеченных в прогрессирование от ожирения к инсулинорезистентности и кардиометаболическим заболеваниям. Обычно считается, что избыточные калории способствуют отложению висцерального жира вокруг органов с последующими изменениями метаболизма жировой ткани в организме и, в конечном итоге, повышают резистентность к инсулину, особенно в печени, в результате глюколипотоксичности [5].Возникающая в результате инсулинорезистентность вызывает нарушение передачи инсулиновых сигналов на инсулино-чувствительные клетки. Фактически, предполагаемая роль этого явления является причиной того, почему терапевтические подходы к лечению инсулинорезистентности и других связанных кардиометаболических заболеваний включают использование агентов, которые способствуют передаче сигналов инсулина.

    Съедобное птичье гнездо (EBN) традиционно потребляется азиатами из-за его пищевой ценности. Считается, что он повышает уровень энергии, предотвращает старение и улучшает общее самочувствие.Кроме того, существуют научные сообщения о его антиоксидантном, противовоспалительном и укрепляющем кость эффектах [6–9]. Однако его влияние на инсулинорезистентность и кардиометаболические индексы не было документально подтверждено. Ввиду широкого покровительства EBN азиатами, особенно китайского происхождения [10], мы решили оценить влияние потребления EBN на кардиометаболические индексы у крыс, получавших питание с высоким содержанием жиров (HFD-). Основываясь на противовоспалительном и антиоксидантном эффектах EBN, мы предположили, что он окажет благоприятное влияние на кардиометаболические индексы, поскольку сообщалось, что оба эффекта способствуют чувствительности к инсулину.В качестве первого исследования такого рода мы выдвинули гипотезу, что результаты могут предоставить доказательства продолжения использования EBN в качестве добавки и могут даже проложить путь для научно обоснованной разработки функциональных пищевых продуктов и нутрицевтиков с использованием EBN для лечения кардиометаболических заболеваний.

    2. Материалы и методы
    2.1. Материалы

    Наборы для ELISA лептина, F2-изопростана и инсулина были приобретены у Elabscience Biotechnology Co., Ltd (Ухань, Китай), тогда как набор для ELISA адипонектина был от Millipore (Биллерика, Массачусетс, США).Наборы липидного профиля были приобретены у Randox Laboratories Ltd (Крамлин, графство Антрим, Великобритания). Набор GenomeLab GeXP Start был от Beckman Coulter Inc (Майами, Флорида, США), а набор для экстракции РНК был от RBC Bioscience Corp. (Тайбэй, Тайвань). Симвастатин был от Pfizer (Нью-Йорк, Нью-Йорк, США) и RCL2 Solution от Alphelys (Тулуза, Франция). Этанол аналитической чистоты был приобретен у Merck (Дармштадт, Германия). Холестерин и холевая кислота были приобретены у Amresco (Солон, Огайо, США) и Santa Cruz Biotechnology (Санта-Крус, Калифорния, США) соответственно.Стандартные гранулы для крыс были из кормов Specialty (Глен Форрест, Вашингтон, США), а пальмовое масло было поставлено Yee Lee Edible oil Sdn. Bhd. (Перак, Малайзия). EBN, происхождения Aerodramus fuciphagus (белый гнездовой свифтлет), предоставленный Blossom View Sdn. Bhd (Терренггану, Малайзия) очищали под водопроводной водой в течение 5 минут, сушили при комнатной температуре и измельчали ​​в порошок вручную с помощью ступки и пестика перед включением в осадок крысы.

    2.2. Биоактивный и приблизительный анализы

    Ближайший анализ EBN был проведен, как сообщалось в нашей предыдущей публикации [11], на основе официальных методов Ассоциации официальных химиков-аналитиков.Вкратце, содержание азота определяли с использованием аппарата микро-Кьельдаля (Kjeltech 2200 Auto Distillation Unit, FOSS Tecator, Hoganas, Sweden), а затем определяли содержание белка как N × 5,95. Кроме того, процесс озоления выполняли путем сжигания образца в печи (Furnace 62700, Barnstead / Thermolyne, Dubuque, IA, USA), установленной на 550 ° C, в то время как содержание жира определяли как высушенный эфирный экстракт EBN. Затем определяли содержание углеводов по следующей формуле: (100% — содержание белка — содержание влаги — зольность — содержание сырого жира).Все результаты выражены в процентах от сухой массы. Количества основных биологически активных веществ в EBN (сиаловая кислота [SA], лактоферрин [LF] и овотрансферрин [OVF]) анализировали с использованием методов на основе ELISA (LF и OVF) и HPLC-DAD (SA). Вкратце, EBN измельчали ​​до порошка и растворяли в воде при 37 ° C в течение 2 часов в инкубаторе с встряхиванием (LSI-3016, Daihan Lab tech Co. Ltd, Корея) и, наконец, фильтровали. Затем водный экстракт использовали для определения концентраций LF и OVF с использованием Chicken Lactoferrin и Ovotransferrin Elisa Kits, Biosource (Сан-Диего, Калифорния, США), в соответствии с инструкциями производителя.Кроме того, водный экстракт EBN также был проанализирован на содержание SA с помощью HPLC-DAD, как сообщалось ранее [12].

    2.3. Исследование на животных

    Комитет по уходу и использованию животных (ACUC) факультета медицины и медицинских наук Университета Путра Малайзии одобрил использование животных в этом исследовании (номер утверждения проекта UPM / IACUC / AUP-R011 / 2014), и с животными обращались в соответствии с инструкциями по использованию животных. Крыс Sprague Dawley (10-недельного возраста, 230–280 г) содержали в птичнике (° C, 12/12 ч цикл свет / темнота) и давали им акклиматизироваться в течение 2 недель со свободным доступом к нормальным осадкам и воде.После акклиматизации крыс кормили HFD, содержащим 4,5% холестерина и 0,5% холевой кислоты, с лечением симвастатином или EBN или без него (таблица 1), за исключением нормальной группы (). Вмешательство продолжалось еще 12 недель, после чего крыс умерщвляли, а их органы извлекали для дальнейших исследований. Кроме того, в конце вмешательства были взяты образцы крови для биохимических анализов.

    7 907 907 907

    65% 907

    Группа животных Нормальные гранулы Холестерин / холевая кислота Пальмовое масло Крахмал
    Диета с высоким содержанием жиров 65% 5 20 10
    Диета с высоким содержанием жиров + симвастатин Симвастатин (10 мг / кг)
    Диета с высоким содержанием жиров + 20% EBN 45% 5 20 10 20% EBN
    Диета с высоким содержанием жиров + 2.5% EBN 62,5% 5 20 10 2,5% EBN

    EBN: съедобное птичье гнездо.
    2.4. Прием пищи и вес

    Прием пищи был рассчитан путем вычитания остатка пищи из того, что было добавлено в предыдущий день. Вес регистрировали после акклиматизации, а затем еженедельно до умерщвления.

    2,5. Биохимические анализы

    Анализы липидного профиля были выполнены с использованием сыворотки крови, взятой в начале и в конце исследования сердечной пункцией после ночного голодания.Образцы анализировали с использованием аналитических наборов Randox в соответствии с инструкциями производителя с использованием прибора Selectra XL (Vita Scientific, Dieren, Нидерланды). Уровень глюкозы в крови измеряли с помощью глюкометра (Roche Diagnostics, Индианаполис, Индиана, США), а гомеостатическая модельная оценка инсулинорезистентности (HOMA-IR), показатель чувствительности к инсулину, рассчитывалась по уровням глюкозы и инсулина в плазме натощак по формуле: HOMA-IR = (уровень глюкозы натощак [мг / дл] / инсулин плазмы натощак [ед / мл]) / 2430 [13].

    2.6. Сыворотка адипонектин, лептин, F2-изопростан и инсулин

    Сыворотка из крови, собранной в простые пробирки, была использована для измерения адипонектина, лептина, F2-изопростана и инсулина с использованием соответствующих наборов для ELISA в соответствии с инструкциями производителей. Поглощение считывали на считывающем устройстве BioTeK Synergy h2 Hybrid Reader (BioTek Instruments Inc., Winooski, VT, USA) при соответствующих длинах волн (450 нм для инсулина, лептина и F2-изопроатана и 450 и 590 для адипонектина). Результаты были проанализированы на сайте http: // www.myassays.com/ с использованием четырех параметрических тестовых кривых: адипонектин (), инсулин (), лептин () и F2-изопростан ().

    2.7. Экспрессия гена
    2.7.1. Дизайн праймера

    Последовательности гена Rattus norvegicus с веб-сайта Национального центра биотехнологической информации (http://www.ncbi.nlm.nih.gov/nucleotide/) были использованы для создания праймеров (таблица 2) в программе GenomeLab eXpress Profiler. . В дополнение к интересующим генам праймеры были также разработаны для генов домашнего хозяйства, в то время как внутренний контроль (Kanr) был предоставлен Beckman Coulter Inc.Праймеры были помечены 18-нуклеотидной универсальной прямой и 19-нуклеотидной универсальной обратной последовательностями соответственно. Праймеры были предоставлены компанией Integrated DNA Technologies (Сингапур) и восстановлены в воде, свободной от РНКаз.


    номер Присоединение Левая последовательность Правая последовательность

    IRS2 NM_001168633 AGGTGACACTATAGAATA AGGCACTGGAGCCTTAC GTACGACTCACTATAGGGA GCAGCACTTTACTCTTTCAC
    KCNJ11 NM_031358 AGGTGACACTATAGAATA CTACTTCAGGCAAAACTCTG GTACGACTCACTATAGGGA GAACTTTCCAATATTTCTTTT
    Insr NM_017071 AGGTGACACTATAGAATA AGCTGGAGGAGTCTTCAT GTACGACTCACTATAGGGA AAGGGATCTTCGCTTT
    GCK NM_001270849 AGGTGACACTATAGAATA ATCTTTTGCAACACTCAGC GTACGACTCACTATAGGGA TTGTTGGTGCCCAGA
    Pklr NM_01 2 624 AGGTGACACTATAGAATA TCGGAGGTGGAAATTG GTACGACTCACTATAGGGA CTCTGGGCCGATTTT
    Prkcd NM_133307 AGGTGACACTATAGAATA TCAAGAACCACGAGTTCA GTACGACTCACTATAGGGA TCTTTCTGGAAGATGGTG
    B2M NM_012512 AGGTGACACTATAGAATA ATGCTTGCAGAGTTAAACA GTACGACTCACTATAGGGA TGCATAAAATATTTAAGGTAAGA
    Hprt1 NM_012583 AGGTGACACTATAGAATA TCCTCATGGACTGATTATG GTACGACTCACTATAGGGA CTGGTCATTACAGTAGCTCTT
    Mapk1 NM_053842 AGGTGACACTATAGAATA CATTTTTGAAGAGACTGCTC GTACGACTCACTATAGGGA AACTCTCTGGACTGAAGAAT
    Prkcz NM_022507 AGGTGACACTATAGAATA CTTTAACAGGAGAGCGTA КТ GTACGACTCACTATAGGGA TATTGTCATGTTTCCGAGAT
    Ikbkb NM_053355 AGGTGACACTATAGAATA CTTGAACTTAAAGCTGGTTC GTACGACTCACTATAGGGA ACATTTTACTGTTGTCAAAGAG
    Кан (г)
    MTOR NM_019906 AGGTGACACTATAGAATA TGGAACTTCGAGAGATGAG GTACGACTCACTATAGGGA TCACTTCAAACTCCACATAC
    Actb NM_031144 AGGTGACACTATAGAATA AACTACATTCAATTCCATCA GTACGACTCACTATAGGGA TAAAACGCAGCTCAGTAAC
    Pik3r1 NM_013005 AGGTGACACTATAGAATA CATCAGTATTGGCTTACG GTACGACTCACTATAGGGA TCATTTACTTCTTCCCTTGA

    Домашнее хозяйство ge другиеГен нормализации. Подчеркнутые последовательности — это левая и правая универсальные левая и правая последовательности (теги). Внутренний контроль предоставляется Beckman Coulter Inc (Майами, Флорида, США) как часть набора GeXP. Условия комнатной температуры были 48 ° C в течение 1 мин; 37 ° С в течение 5 мин; 42 ° С в течение 60 мин; 95 ° C в течение 5 минут, а затем выдерживают при 4 ° C. Условиями ПЦР были начальная денатурация при 95 ° C в течение 10 минут, за которой следовали двухэтапные циклы 94 ° C в течение 30 секунд и 55 ° C в течение 30 секунд, заканчивающиеся одним циклом удлинения при 68 ° C в течение 1 минуты.
    2.7.2. Экстракция РНК, обратная транскрипция и ПЦР.
    РНК

    экстрагировали из печени и жировой ткани с использованием набора для выделения тотальной РНК (RBC Biotech Corp., Тайбэй, Тайвань) в соответствии с инструкциями производителя. Обратную транскрипцию (20 нг) и ПЦР проводили в соответствии с протоколом GenomeLab GeXP Start Kit (Beckman Coulter, США), используя условия, указанные в таблице 3.

    9070 0,54 ± 0,06% 907.9 ± 0,27%

    Биоактивное / питательное вещество EBN

    Лактоферрин 4.68 ± 0,4 мк г / мг
    Овотрансферрин 10,23 ± 0,8 мк г / мг
    Сиаловая кислота 110,4 ± 0,8 мк г / мг
    Зола 4,0 ± 0,03%
    Влага 15,2 ± 0,02%
    Углеводы 23,4 ± 0,29%

    2.7.3. Система генетического анализа GeXP и мультиплексный анализ данных

    продуктов ПЦР (1 мкл) были смешаны с 38,5 мкл раствора для загрузки образца л и 0,5 мкл л стандарта размера ДНК 400 (GenomeLab GeXP Start Kit; Beckman Coulter, Inc, США) на 96-луночном планшете для образцов и загружены в систему генетического анализа GeXP genomelab (Beckman Coulter, Inc, Майами, Флорида, США), которая разделяет продукты ПЦР в зависимости от размера с помощью электрофореза в капиллярном геле.На рисунке 1 представлена ​​типичная электрофореграмма. Результаты были проанализированы с помощью модуля анализа фрагментов системного программного обеспечения GeXP и нормализованы в программном обеспечении eXpress Profiler.


    2,8. Анализ данных

    Для анализа использовали средние значения ± стандартное отклонение () групп. Односторонний дисперсионный анализ (ANOVA) был выполнен с использованием программного обеспечения SPSS 17.0 (SPSS Inc., Чикаго, Иллинойс, США) для оценки уровня значимости различий между средними значениями с пороговым значением.

    3. Результаты и обсуждение
    3.1. Ближайшие и биоактивные анализы

    Ближайший анализ EBN показал, что он содержит в основном белки и углеводы (таблица 3), что согласуется с предыдущими выводами [10]. Кроме того, он содержал значительное количество SA (11%) как биоактивных, с меньшими количествами LF (1%) и OVF (0,4%). Предыдущие отчеты показали, что EBN богат биологически активными веществами [10], и вполне вероятно, что синергия с пищей играет роль в его общих эффектах [14].Присутствие какого-либо одного биоактивного соединения не может объяснить биоактивность EBN, но концентрация ведущих биоактивных соединений, таких как SA, может иметь большое влияние, хотя и с вкладом других биоактивных веществ. Более того, SA, LF и OVF, как сообщается, обладают различными функциональными эффектами [15, 16], и их синергизм может даже лучше. Это похоже на концепцию биоактивно-богатой фракции, которую мы недавно отстаивали, согласно которой биоактивное соединение свинца в экстракте обеспечивает лучшую биоактивность в присутствии других биоактивных соединений [17].Поэтому, принимая во внимание недавнюю пропаганду изучения пищевых продуктов, но не их отдельных составляющих, в качестве функциональной единицы питания [18], мы решили изучить биоактивность EBN в целом.

    3.2. Изменения массы тела

    На рис. 2 показаны изменения массы тела крыс за 12 недель вмешательства. Статистически значимых изменений не наблюдалось, но изменения в группе, получавшей HFD (необработанный контроль) (увеличение на 50%), были выше по сравнению с нормальной (47%), симвастатиновой (40%), 2.5% EBN (45%) и 20% EBN (43%) группы. Интересно, что, как показано в Таблице 3, потребление калорий для разных групп было одинаковым в течение периода вмешательства. Таким образом, результаты показали, что EBN обладает некоторыми свойствами, регулирующими вес, хотя прирост веса был самым низким в группе, получавшей симвастатин. Кроме того, сообщается, что симвастатин обладает некоторыми свойствами снижения веса [19].


    3.3. OGTT, инсулин, HOMA-IR и липидный профиль

    Уровни инсулина в сыворотке крови в конце вмешательства существенно не различались между группами, за исключением 2.5% группа EBN, что было значительно ниже (), чем в других (Таблица 4). Однако абсолютные уровни инсулина могут не отражать состояние лежащей в основе чувствительности к инсулину, поскольку инсулинорезистентность часто начинается с высоких уровней инсулина и заканчивается более низкими уровнями. Поэтому мы вычислили HOMA-IR как маркер инсулинорезистентности, который объединяет уровни инсулина и уровни глюкозы натощак. Данные показали, что нелеченные контрольные группы и группы симвастатина имели тенденцию вызывать инсулинорезистентность. Это отражает более ранние данные о влиянии кормления HFD [20] и симвастатина [21] на развитие инсулинорезистентности.Группы EBN имели более низкие значения HOMA-IR по сравнению с другими группами, хотя существенно не отличались от нормальной (обе группы EBN) и необработанной контрольной (группа 20% EBN) групп.

    ± 9 3.6 ± 1,1 б, в 0,79 c ± 817,00 712812 8 2,63 ± 0,08 a

    Группы крыс Прием пищи Хол. (ммоль / л) Триг. (ммоль / л) ЛПНП (ммоль / л) ЛПВП (ммоль / л) ЛПНП / ЛПВП ТГ / ЛПВП Инсулин (пг / мл) HOMA-IR
    г / кг / день Ккал / кг / день

    Нормальный 64.34 ± 10,96 215,54 ± 33,5 a 1,55 ± 0,43 a 0,62 ± 0,15 a 0,28 ± 0,11 a 1,18 ± 0,35 a 1,18 ± 0,35 12 0,07 9124 9124 12 0,07 0,55 ± 0,15 a 495 ± 51,3 a 1,91 ± 0,23 a, c, d
    Необработанный контроль 48 ± 8,36 215 7.47 ± 1,13 б 1,21 ± 0,38 б 4,98 ± 1,03 б 1,05 ± 0,13 а 4,77 ± 0,98 б 1,16 ± 0,33 б 38,8 a 2,46 ± 0,22 b
    SIM 48,14 ± 8,17 215,67 ± 36,60 a 4,99 ± 1,11 c, d 0,67 1,04 ± 0,17 а 3,46 ± 0,94 б, в 0,62 ± 0,22 а, б 602,1 ± 145,7 а 2,912 б, в
    2,5% EBN 48,23 ± 8,21 216,07 ± 36,78 а 6,04 ± 0,75 б, в 0,54 ± 0,1 а 902 ± 0,7 1,17 ± 0,18 a 3.94 ± 0,88 b, c 0,46 ± 0,08 a 414,5 ± 18,8 b, c 1,74 ± 0,09 c, d
    20% EBN 48,3 216,52 ± 35,84 a 4,17 ± 1,06 d 0,44 ± 0,1 a 2,98 ± 0,83 c 1,18 ± 0,29 a 426.7 ± 160,7 a.c 1,63 ± 0,71 a, b, c

    Данные представляют собой среднее значение ± стандартное отклонение (). Различный алфавит в каждом столбце означает значительную разницу () в тесте множественного сравнения Тьюки. Группы такие же, как на рис. 2. ЛПВП: липопротеины высокой плотности; HOMA-IR: гомеостатическая модель оценки инсулинорезистентности; ЛПНП: липопротеины низкой плотности; Хол .: холестерин; SIM: Симвастатин; Условное обозначение: триацилглицерид.

    Уровни холестерина в необработанной контрольной группе были значительно увеличены по сравнению с нормальной группой (Таблица 4). Более того, ухудшение липидного профиля связано с инсулинорезистентностью [22]. Общий холестерин был значительно снижен в группе симвастатина и 20% EBN (). Как видно из других показателей холестерина в таблице, симвастатин, который используется для лечения гиперхолестеринемии, был способен улучшить липидный профиль, но не так хорошо, как лечение 20% EBN.Кроме того, на рисунке 3 показаны результаты OGTT для групп вмешательства. Гликемический ответ в группе, не получавшей лечения диабетом, был выше, чем в других группах (), в то время как в нормальной группе и в группе EBN был самый низкий и значительно ниже, чем в группе, получавшей симвастатин (). Инсулин регулирует ряд метаболических изменений в организме, и нарушения в его действиях даже до того, как инсулинорезистентность становится явной, можно обнаружить с помощью OGTT. Это связано с тем, что OGTT дает представление о том, как биологическая система будет реагировать на присутствие глюкозы, и показывает, насколько хорошо постглюкозный выброс инсулина справляется с гликемической нагрузкой, полученной в кровотоке [23].В этом исследовании данные показали, что необработанные контрольные группы и группы симвастатина не справлялись с глюкозной нагрузкой в ​​соответствии с уровнями инсулина, наблюдаемыми в сыворотке. Следовательно, несмотря на отсутствие разницы в уровнях инсулина между группами, данные OGTT показали, что необработанные контрольные группы и группы, получавшие симвастатин, будут иметь аномальные гликемические ответы по сравнению с нормальными группами и группами EBN, потому что их тела имели тенденцию к инсулинорезистентности.


    3.4. Сывороточный адипонектин, лептин и F2-изопростан

    На рисунке 4 показаны результаты для сывороточных уровней адипонектина, лептина и F2-изопростана. Результаты свидетельствуют об ухудшении показателей метаболизма (повышение лептина и F2-изопростана и снижение адипонектина) в необработанной контрольной группе по сравнению с нормальной группой. Группы EBN показали дозозависимые улучшения (снижение лептина и F2-изопростана и повышение адипонектина) метаболических индексов, хотя только группа с 20% EBN была значительно лучше, чем группа нелеченого контроля.Адипонектин и лептин являются адипокинами, которые имеют обратную зависимость и оба участвуют в развитии инсулинорезистентности. Низкие уровни адипонектина и высокие уровни лептина указывают на склонность к инсулинорезистентности, в то время как вмешательства, обращающие эти тенденции вспять, улучшают чувствительность к инсулину [24]. Кроме того, F2-изопростан является маркером окислительного стресса, который также связан с инсулинорезистентностью [25]. Фактически, предполагается, что оксидативный стресс предшествует инсулинорезистентности [26], в то время как антиоксиданты и меры, снижающие уровень оксидативного стресса, как полагают, улучшают чувствительность к инсулину [27].Таким образом, основываясь на тенденциях, наблюдаемых в настоящем исследовании, можно утверждать, что EBN предотвращает индуцированную HFD резистентность к инсулину у крыс, частично благодаря своей способности снижать окислительный стресс.

    3.5. Уровни мРНК в печени и жировой ткани сигнальных генов инсулина

    Полученные на данный момент данные показали, что EBN способен предотвращать инсулинорезистентность у крыс, получавших HFD в течение 12 недель. Кроме того, данные показали, что, хотя симвастатин способен производить более низкие уровни холестерина, он, по сути, увеличивает инсулинорезистентность, что согласуется с предыдущими сообщениями [21].Основываясь на том факте, что уровни инсулина были одинаковыми между группами в этом исследовании, но были значительные различия в чувствительности к инсулину, мы предположили, что изменения чувствительности к инсулину могли быть опосредованы на уровне передачи сигналов инсулина. Таким образом, мы определили влияние наших вмешательств на регуляцию транскрипции сигнальных генов инсулина (таблица 2) в печеночной и жировой тканях.

    Экспрессия сигнальных генов инсулина в печени и жировой ткани была характерной для инсулинорезистентности в необработанной контрольной группе; Подавление рецептора инсулина (Insr), субстрата рецептора инсулина (IRS) 2 и фосфоинозитид-3-киназы (PI3K), наблюдаемое в печени и жировой ткани в этой группе, указывает на резистентность к инсулину (рис. 5) [28–30] .Активация инсулина инсулином обычно инициирует каскад, который включает активацию IRS и, в конечном итоге, PI3K, которые опосредуют внутриклеточные действия инсулина. Нарушение транскрипции этого инициируемого инсулином каскада является частью основы инсулинорезистентности, вызванной ожирением [31].

    Кроме того, повышенная регуляция митоген-активируемой протеинкиназы (MAPK) [32] и ингибитора энхансера гена каппа-легкого полипептида в B-клетках, киназы бета (Ikbkb) [33] и подавление активности рапамицина-мишени млекопитающих (mTOR) [34] ] и протеинкиназа С, дзета (Prkcz) [35], как видно из необработанной контрольной группы (фиг. 6), как полагают, способствуют фосфорилированию IRS с последующим увеличением инсулинорезистентности из-за нарушения IRS-опосредованного действия инсулина посредством активации PI3K [28, 30].Вмешательство с помощью EBN увеличивало экспрессию Insr, IRS2 и PI3K как в печени, так и в жировой ткани, но разница была значимой только для IRS2 в печени и PI3K в жировой ткани (рис. 5). Это, однако, предполагает, что EBN предотвращает HFD-индуцированную резистентность к инсулину посредством регуляции транскрипции сигнальных генов инсулина. Более того, EBN активировал mTOR и Prkcz в печени и жировой ткани, но вызывал только подавление MAPK и Ikbkb в печени, что указывает на то, что изменения транскрипции, вызванные EBN, по-разному влияют на гены передачи сигналов инсулина в печени и жировой ткани.Следовательно, в усиленной передаче сигналов инсулина в разных тканях могут быть задействованы несколько разные механизмы.

    Активность глюкокиназы (Gck) и пируваткиназы (Pk) влияет на инсулинорезистентность, снижая шансы внутриклеточного фосфорилирования глюкозы и ее приверженность гликолизу [36]. В жировой и печеночной тканях необработанной контрольной группы мы наблюдали подавление генов Gck и Pk в соответствии с повышенной инсулинорезистентностью (рис. 7). Считается, что уровни этих генов напрямую влияют на уровни клеточного аденозинтрифосфата (АТФ) и, следовательно, на активность канала внутреннего выпрямления калия, подсемейства J, гена члена 11 (KCNJ11), который регулирует ионные каналы, участвующие в ощущении глюкозы [ 37].В этом исследовании мы наблюдали подавление гена KCNJ11 как в печени, так и в жировой ткани, предполагая, что изменения в экспрессии Gck и Pk могли повлиять на его экспрессию через их влияние на клеточные уровни АТФ. Вмешательство EBN способно активировать экспрессию Gck, Pk и KCNJ11 как в печени, так и в жировой ткани.

    Основываясь на паттернах экспрессии в печени и жировой ткани, мы предполагаем, что EBN может оказывать свое влияние на чувствительность к инсулину за счет повышенной экспрессии и вероятной активности нескольких генов, участвующих в сигнальном пути инсулина в печени и жировой ткани (рис. 8).Хотя симвастатин способен снижать уровень холестерина (таблица 4), его влияние на сигнальные гены инсулина (рисунки 5, 6 и 7) имеет тенденцию к инсулинорезистентности, что согласуется с предыдущими сообщениями. Печень и жировая ткань участвуют в развитии инсулинорезистентности, и фактически они были предложены в качестве органов, откуда возникает проблема. Следовательно, повышенная чувствительность к инсулину в этих тканях предполагает, что EBN эффективен в предотвращении инсулинорезистентности. Кроме того, мы предполагаем, что синергизм нескольких биологически активных веществ в EBN способствует общей наблюдаемой биоактивности.


    4. Выводы

    В этом исследовании мы продемонстрировали, что HFD вызывает инсулинорезистентность (более высокие уровни OGTT, лептина и F2-изопростана и более низкие уровни адипонектина), частично за счет транскрипционной модуляции сигнальных генов инсулина. Кроме того, было показано, что симвастатин дополнительно способствует инсулинорезистентности. EBN, однако, способен предотвращать инсулинорезистентность, предотвращая некоторые транскрипционные изменения сигнальных генов инсулина, вызванные HFD. Существует необходимость в дальнейшей оценке потенциального использования EBN для лечения инсулинорезистентности в уже установленных инсулинорезистентных состояниях.

    Аббревиатуры
    9070A IR с высоким содержанием жиров. 9070 7 Pk:
    EBN: Съедобное птичье гнездо
    Gck: Глюкокиназа
    HFD: Диета с высоким содержанием жиров Модель
    Ikbkb: Ингибитор энхансера гена каппа-легкого полипептида в В-клетках, киназа бета
    Insr: Инсулиновый рецептор
    IRS: IRS: Инсулиновый рецептор Калий, выпрямляющий внутрь канал, подсемейство J, член 11
    Mtor: Млекопитающее-мишень рапамицина
    MAPK: Митоген-активированная протеинкиназа 907 Толерантность к глюкозе
    PI3K: Фосфоинозитид-3-киназа
    Пируваткиназа
    Prkcz: Протеинкиназа C, дзета.

    Ответить

    Ваш адрес email не будет опубликован. Обязательные поля помечены *